Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y76G2B.b   

sjj_Y76G2B.bRNAiJA:Y76G2B.b
PCR_productsjj_Y76G2B.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC34G6.1 Source_evidenceePCR2063WS150 Sequence/Annotation Release
Overlaps_Gene C34G6.1 Source_evidenceePCR2063WS150 Sequence/Annotation Release
Chunk_score Abs_score2000
Max_abs_score2000C34G6.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI59153965917696
Overlaps_transcriptC34G6.1 Source_evidenceePCR2063WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y76G2B.b2301atgacagtcctggttctacgtgtttattatgaatgtgcagaggacatatcattggggcatgcttcagattttgagccattgagctcacttctcggacgtctggctccacgtcttattgatcttcttgctcatgttcgacttcaagccttatcagcaattcattggacactacgacttgcctatatgcacaaaggacatggaagagatgctgatcaaagtctattttcttattctggatttgttgagaaatatttgacaagtggagatgtaaaattagaaggacagaaggaaaaattggcaattgaagcaattgctcaaattatagaatatcgacttcctcagtctcaaatgcaaatctatttgtcagcaatatttgaaatgctgacagatcgacaaagtcacgtgagttctgcggcagctcaacttctcacctacgcagtaatggcaagaggagcaacactcaacgctgaagccgagattcttgtgacaaaaatggttgagaaactggcagatatacatcattgcgtacaaactaacactgatgtccttgctgcacttgttgcgttcgctgtacatcaacagcaagctgtatgtgatgttcttttcaagcaaccacttccatattcgatgtgagtttttttttaataaaaagataaaaaggaacaattatatttttcagtaacatcacggacgcttgggaatgtctttctcgggataaacttctatttgctgtaatcctcgatcatctcactgaacttcttggtgcaagtcttgatcaaccctttgaactgatggattctggtggaggtgtttctgcgaaggttgtcaacgtggaaccatgcacttacgtcgcagttttggctgaagtcgttaaaaacggagaaccagaatcggcactgatggaacgtcttccattaattctcactcttctcattcactttatttgttcagtctcggacactcaatttccagtaatgcagaaagaaggttcaaagaatccactgattattacacccgatcttcggagagctgctgaaaagccagcaggaatggctgttgctgctatcaagaacctgctgaaccgaacgagatctaatatggtaattgaggatatgaatcaagcgagagcatggactgactgtcttgacaaggattcttttattcaagcaatcactgtttttattcgatctctagttgaacaacgtcctgcgtgggtttccccacttgcaaagacgatggaagaatatgcgaatagtgaaagtgaaccacgtcggcttgctgcagttatcattgcagcatcgttgatacgtcgaagtacttctgaaaatggagaattcaatgaacaacttctggtcaaatgtatacgtcgtctcgaagattctttgacagatccaagccttcgaatccgtaagctgtgtgtgaagggtcttggagaattatctgaatgttcttcaactgatgttatatcaagatttgtgcatatggctgtagaagcagcgatgtctggattagatgatcatggagatcgtaaggatactgtagctattgaatccataatggcattgaataagcttgtccagttaactaacaatgatcagttaaaatcaatacttccacttgttctactcaagattcgaccatgttttgagaaagattcccacactctgcgagcagcatcattcagtttatttggagagcttggatccagagttggtgagaacagtgaagaattcagaggtcacctacatacaaatattgtctcacttctacttcacttgaatgatgatttcgaagaagttcgacagaactgtgctaactcgatatatcggcttcatggcctgctcacatccccgaatgcatcaatatgtattgaacgtgaattgaaggatggaaaacaaccggccagctataatctattcatcaaggatttcgcttcaattttggtatggcattttgatttttgatttctagaattaatattaccattttattgcaattaattttgggtaatatattgggtaatattgggtaattggtaattagttaggtaaaaaaataggtaaaaagtaagtgggaaaatacatttttttttaaaataaatatttttagagaaaccaaaattaattttcaggccaactcatttcctgatcggatcaatcaatatgctctcgccacttccaattatttcaaaagttcaagtgccagaatacggtgtaatgcggcacatcttactggatgtcttttggatggactcactgctccactcagagctacaatcagtcgagagcttgtattcactgg