Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y80D3A.a   

sjj_Y80D3A.a RNAi JA:Y80D3A.a
Simmer:Y80D3A.a
PCR_productsjj_Y80D3A.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY80D3A.1 Source_evidenceePCR486WS150 Sequence/Annotation Release
Overlaps_Gene Y80D3A.1 Source_evidenceePCR486WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV1885837118859393
Overlaps_transcriptY80D3A.1 Source_evidenceePCR486WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y80D3A.a1023aaaagaaaaattacgaaaacgccaggaatctaaaattgcattcgttttttcgcaaattttcaattttggagggatttgtctaattttcggtcgttttttcatgaaaaaactcaattttccgtcgttttttcatgaaaaaacaaaattttcgttcgtttttccgtgagaaaactcaattttcggtggttttttcacgaaaaaactcaattttcgttcgttttttcatgaaaaaactcatttttcggtcgttttttcaagaaaaaactcaattttcgctgctaatcaccttattcttaatctgtttcgccgtatcactcaaaaagatacacgtattcggctcagaagcgctcatcttcgtctgtgctcccgtaagagccggtaggaatgtggaaaagattaaagatggcttagaggccttcaatcttggagccacgtcacgtgtcatacggaaaaatgggtcctggtcgatggcacacgggatcagacatggaatatcgtttcgttttccgaaaatttgtggaaatgatgaagcaaagcacggagccgcttcgacagccggaaaagccgcttttccgagacaatcctcgggggtgaagccgaaaatcgctcgggcctgattcgtattgacgactttccagattttgacgatattctcgtagaacggtgggcacatgtagtcgaaattgttgaaaatgaaggtttttgtcggatcaaaaccgacggaaatgatgtctttcatgttttcacgggccatttttttcgcctcgtcgacctgaaatttgaatgaaaaaatgaacattttttagacttcaaaaaatttgtgtcccgacaattgcggggacatgggacagacactccacgtaatttttcagtaatgttttcaaattcgctatgaaatttccgaaattttaacacccatattgactaggttctgagaattggaaagttcaggccgatataggccgattctgggccgtttcgggcctaaatttgtacattttgaaaaacctagcctatgtgcat