Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y87G2A.u   

sjj_Y87G2A.uRNAiJA:Y87G2A.u
PCR_productsjj_Y87G2A.u
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY87G2A.12 Source_evidenceePCR2124WS150 Sequence/Annotation Release
Overlaps_Gene Y87G2A.12 Source_evidenceePCR2124WS150 Sequence/Annotation Release
Chunk_score Abs_score2103
Max_abs_score2103Y87G2A.12
Specificity_index0.661
Rel_score1
Map_statusUnique_ePCRI1359491813597163
F41B5.6 Chunk_score Abs_score372
Specificity_index0.117
Rel_score0.177
K01D12.2 Chunk_score Abs_score635
Specificity_index0.2
Rel_score0.302
Y50E8A.8 Chunk_score Abs_score70
Specificity_index0.022
Rel_score0.033
Overlaps_transcriptY87G2A.12 Source_evidenceePCR2124WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y87G2A.u2246ctctacccctttctgatcccttaatctatacattcttattaacaaactattatacgggaaatattggaatccttttccgtacatggtgacccagtggtgaagaacaactgcacccagtcaagatgagcagtattctcaaagctcaactcaacattgcacgaaaaaagttgcaaaagcagatcaatcaggccaatcaactcgtgaatgaagtcaacaacggacttaactcaacagacaatgaaaatatctacgacacaataacagaagccgcggatgttgcaagagaaattcaatcggaaatgaatcgaatcacccaatatatgaaacaatggaacaatcaatcacaattgttggatagtgaagctatcaacgaacaccaatcaacaaaaagaaatttcatgtcggaattgaaattgtccaccgatgtactgtctcagctcaaggagaagtacaatgcatacatgaaaatgcacaaatcaagaggtcccgaccaagtggactacccaccgtttccagttttatcaacggattcaattgttcctgagtgcaattctaactcaacaacacaagattcggttccacaatattcatattcacctgcaactcacactgatgttcctctactatttattaacaatcaacaacgggcacatgaaagtcaacaacatcacatatccactcatcaacagggacaaatgcattttagtccaatccagtctcaagggattttcggagcttgctcaatttcaactcagcaattttcttctacaatttcatatattccgattcaacctgctactattgccatgcctacttttagcggcgatatcttgcactatcaatcattcatggagttattcaacacattaatcgacagtcaaccaattgcggagattttcaagttctactatctcaaatcagctcttcaagaaaatgctgctcgtataatccatcatttaccactcacttctgcaaactatcatgtggcttggaaattgttaaaagaacggttcgataatactacaatacttcgtcatcttctgttgcgtaaacttcaagaaattcaacctgtgcccaagaaccacagtttgcaacaaatacaacaactttggactgagtttgtttccattttcaaccaattgtgcaaaatacaacctgacgcggacaacacaatgattgccaacattatcacaagcaaactaccacgtcgttacatcaagcggatatatttcggacaccgaggctgtaattatctggcatcagaaatattggagatggtgcggtcattcattcaaacagactttattgtggatataattgcgaatgatgctgaagcacatcaatattcaacttacaactgtgaaagtcttcaaccggtattcaaaaacccagtaactggaaatcacgttcaactagaagaaattcatcattcgagcaaagcaaaccatcacccacaaagagtacaacatcatctacaacaaaacagtgtgcatacttcaattgctgaacgaacagatcagcaaccacttgttgagccaacttctggaatacaactgacttcatcaacagcagtgaaaatcaagtcgaatatcaatgcagaaaccttagaaattcctccaattgctgaaataccaaaacaaaaatgcaaccaatcggaaatgagcagtacagaaactttggaccaagttctctcattgccagttcaacccaagataatttcaattggactagctgcacaacaattgcaaagtgaacagcttgatgaagaaaatccagcaatggttttggaatccactaacgaagacgagttcgaaattattcccatggaaactatcatcagcaacaacgaaatcggaaatcaaattgacgtcgaggactcgcagcagttggattcaaaggatcagtatcaaaaagtatcagaacttcaagatgattttatcgaaaccgtggaaacaaagtccataacgcgaatcaacaatgaaggattttctccagatgcaatggagaaatacggacaaagcagaagcagtttttcttctgaaaaacactccaccaccacacattacacgccagctgaagaatcacataactttggattcaatcttcacgtagaccacaagataacaactcaatggcaagatgataagcatccctgggatccagggacacaacaaagatatcaactagcgcctcgaacacaatggatgcctaaaccactgctcgatcaagcagcgatattgtcattt