Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y87G2A.x   

sjj_Y87G2A.xRNAiJA:Y87G2A.x
PCR_productsjj_Y87G2A.x
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY6B3A.1a Source_evidenceePCR1138WS150 Sequence/Annotation Release
Overlaps_Gene Y6B3A.1 Source_evidenceePCR1187WS150 Sequence/Annotation Release
Chunk_score Abs_score1040
Max_abs_score1040Y6B3A.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1360417313606489
Overlaps_transcriptY6B3A.1a Source_evidenceePCR1187WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y87G2A.x2317aagagccacacaaaaatgagaaattaatcagagctgtggggagctagcttcaagtgaaattttccgaaatatgggatttctgagattcttctagcgcttcttgaacagttgttggtgatttcgtttgaaaattgattattcgtcggaagagctcggcgagcagttttcgcatcgtttgatcttcggccgtttcaacgagatcgcagagtctgaaatgaagtgaatgtatatttttctcttttcatatatatatataggttatttaatatggatacatgatcataataactattcgttaaaatggttgtagtttgtagtttgtatttttcaaaaaaaaattcattacgatctacatttttgtcataaatcaataattacatatatttttgcaaattaaatttttttgatttttttttaatcgagaattttcagttttggttttttttttcgattttgtagtttgtagtttgtagtttgtagcctcactttaatggaaactccggcccaagtaccggaatcaagttggtcggaagtgcaatgcattctctcaacaattcacaaattactggtccatacgcagtccgcctggtgtcggattcggcttctccgtagccgctgagcgcaagtgaaacgactctgaaaatgtgtagtatttgtagtgtgtgtgtgtgtgtgagcctcaaccaaaacacttactctaacactcgaatcgcaattttgtcagaaatcgattgggctcggagatcgtagagcaggcggaatagaatagccaacattgcacttagcgatcgcgtttcttggctgaaaatatgattttatagtttatagtttatagtttgtagtttgtagtatgtagcctcacttgatcaaattgggcttcgtagatccaagtagtcgtgctttccaaatcaatacacgttgcccattattattattgaattgtttcgccagtgtatgactttccgcgagagcatcacaaatgctcaaaagtaattgtggtgacatttgagtgaataggccatcgatttgaagatctcgtttactttcccgatggtctccgagcacaatccgggagaccgcttcgacgagctcattttgtacaacacagaagacgatttgttccgatgagagagtgtcggatctggaagaataattgtagtttgtagtttgtagtttgtagtctaaatcttaatatagtgtgtattatagaatgtagtttgtaatatagttagcagtgtagtgtttagtctactacagaatttctgagcttcaccatcaaatggttgaggctggaaatttgtagtctgtagtcttaaccattaattaataaaccaataatccttagatttttcttattttttcgccaattttcccgtaaaactaacccattcgtccgatcctccgacccaattccattagaattcggcggctcccatgtgagcaacgatttcggcagtgtcgtctcaaatagctcccgaatcaattcaatagtctgttcccacattggctcagtgaatcgttctccgttctgtgagattagtgattccaggcaactaatcgtacatctggcgagctgttcgttttctgaaattgaaatggttgaggctgagagactacaaactataaaagatacgttgtcgaataaagattccaaattgacgatagatcattggaagtgcgtagacggagagttgagtgtagaattgtgtgaacacttcgacaacactcaacattgcatgattacacgtcgttgacatccattctcgcttctgaaacttgtgattggttgaggctgtgaggaggaagactacaaactacaaactacaatagttttcgatatattgttagctctcatagtaaatatactttttgatattaaaaaaaattcattttttgccgaaaaattcaaatttttcgttaaaaataattttttggcgggaaattccgaattcggagaaaaattatatgtaaatgcatgccaattttttttaaatattacaattttccagttcttaataaattccaaaagtttcaggaagttcagtgactacaatctacaaaattttatagtttgtagtgtgcacgccagtcaaaaatcaaactcaatcgggtaaaaattagtttttgtcaatgttttcatgttttaaatacgttacactataaaatgtacaacgctatgaataactacaaactacaaaaagtgctcacatcacttcgatgatcgtccattttcgatggatcaaaaatgcgaaaaacgatttccaacagatccttccaccattctggcctaaaatccgatccatgatgtttcataatt