Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y8G1A.1   

sjj_Y8G1A.1RNAiJA:Y8G1A.1
PCR_productsjj_Y8G1A.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY8G1A.1 Source_evidenceePCR545WS150 Sequence/Annotation Release
Overlaps_Gene Y8G1A.1 Source_evidenceePCR545WS150 Sequence/Annotation Release
Chunk_score Abs_score461
Max_abs_score461Y8G1A.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI37466023748379
Overlaps_transcriptY8G1A.1 Source_evidenceePCR545WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y8G1A.11778gcacatgtgttctttcttcctttgagatcggctctcttttttattagaatacattttttttcgatttttcagaaaatgacaggaaaaacatttttgttaactcatacattcaaggatatatcgaaactcggagaaggaggcacttactacagtgataatgaaatacgacataatattccatggtgagtcatattattattatgaaatagactttgtcgcatccaaaatactttgaaagttagctcgatttttctaggaaacttcaaatattccgataatggcagttaccatcaggaggtacccttacgatccttcttatctgaaggatcagaacatcagaaggtgcccatgtgatccttcggagctgaaggatcagaacatcaggaagagcctcgtgatcctttggagctgaagtatcagaccatcaggtggtacccttacgatccttcttatctgaaggatcagatcatcagaagatgcccatgtgatccttcggagctgaaggatcagaacatcaggaagagcctcgtgatcctttggagctgaagtatcagaccatcaggaggtacccttacgatccttcttatctgaaggatcagaacatcagaaggtacccatgtgatccttcggagctgaaggatcagaccatcaggaagagcctcacgatattccaagttagttggacgttttacagcttttcccaaaagaccatcgttcatacattcaattgtgagggaattataaccgataatcgattgaaaattgcattaaaaaacttattccagaaaaatgtgaacaaaaattagttgaaaaatacatataaaaatctagtggaaaaaaagaaaatacaataaatacaaatgaacttgcgaaaatacaaatgaacttgcggcgactcaagatccaaattatcaaactttggcgggtttgaataatgacgcagtgtttggaccaggaggcggaggtaagatatatcaagattgaataatttctgaaataattatgtttagagggtggaccaccgagagctccagctccaggctcaaaaccaggaatggccggaactcaggatcccaactatcagacactggcaggtctcaataatgatgctgttttcggaggtggagcaggcgggcctccaaaggctccagcggtcggaggaaaagctgcaaccaatgatccaaattatcaggttagttttggattgcaggcactgaaaaaagtttgaaaaacatatataattcagactctcgctggactcaacaacgacgaaattttcaagccgggcggcgctggagcgccagctggtccaaaagccccacttgctccaggtgcaaaagctggaacaaacgacccgaactaccaaactcttgctggactcaacaatgatgacattttcaagaaaggtggaggtggtggcggtggtggtggacctccacgtgcttctgctcaagtcggtgcaaaagctgcgactcacgaccccaattatcaaacgttggccgggttgaatcaggatattttcggagctgataagaagaagttttaatgggatctggactaatttgtagaaagattagcgatatcttttgaatacgatctatgaataaatttgtgtgaatagtcgccgaggctcttcctttttaaacggaagagccagacatgaattatgttaattaaagttaggaatttttaagcaattggcaaaaattgttagaagacaattttttataagaacaaaagacttatggactgtcaaggaagttcgagaaaagaattgg