Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y95B8A_84.b   

sjj_Y95B8A_84.bRNAiJA:Y95B8A_84.b
PCR_productsjj_Y95B8A_84.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY95B8A.11 Source_evidenceePCR220WS150 Sequence/Annotation Release
Overlaps_Gene Y95B8A.11 Source_evidenceePCR220WS150 Sequence/Annotation Release
Chunk_score Abs_score73
Specificity_index0.21
Rel_score0.265
Map_statusTop50_percentile_ePCRI889893890627
Y95B8A.6 Source_evidenceePCR317WS150 Sequence/Annotation Release
Chunk_score Abs_score275
Max_abs_score275Y95B8A.6
Specificity_index0.79
Rel_score1
Map_statusBest_ePCRI889893890627
Overlaps_transcript Y95B8A.11 Source_evidenceePCR220WS150 Sequence/Annotation Release
Y95B8A.6a.1 Source_evidenceePCR317WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y95B8A_84.b735gaaattaaatacggatgctgctgccaaatatgctgccaaattcaaattctcgccttgtacacacgatctttattgaaaacggtgatcaacgggcaccctccactctgaccttttatctgaaaataattgttttaaagatttatttgattaaaaacctcggccacggccgcgacgcagccgctccgcacgcagctgcgtcgcggtcgggtggatcctaacctgaacttctccctccagctcgttatcgtcgtcgaccacctcgaacagtttgctagcctcgaatagaaatctgaaaaaaataaattggttttttttgaaaatatataatgttttatgtttgggcttctggccttcctcattgcatttttcgcgcgctccattgacaatcgcccccctgtgtactccacacggacaaatcacatttagtttcacaacgaacgacacgcaacgcgcctggcctagttcggcagaaaaactcttccatttcaatttatgagggaagccagaaatccgcgtgtgttttattgattttattgatttttttactttcgaaaatcgcgttccggctggtagaagcacaaggttttgcgcgtgtcggcgattcgatccctcgaccattctctgcaaaaaaaatatttttttttgtgtaaaattcccaatctgcgagaacgggatctacgaaaaattttttttttaatattttaatgattttttcagagatcacattcttgcaga