Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y95B8A_84.i   

sjj_Y95B8A_84.iRNAiJA:Y95B8A_84.i
PCR_productsjj_Y95B8A_84.i
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y95B8A.6 Source_evidenceePCR247WS150 Sequence/Annotation Release
Chunk_score Abs_score187
Max_abs_score187Y95B8A.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI882717883545
Overlaps_transcriptY95B8A.6a.2 Source_evidenceePCR247WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y95B8A_84.i829ctctcaattcttctctgcctcctcctcctcctcctcctcctcccaattctcatgtcatcggggggcccgtcgtgtcgtcgagcgccctctcgcgtctgcaatgtctcggcgccgccgccgtcgtcgtcgtcgtcgtcgtcgtcttcggggggttgtcatctgctgtgttcacactgatgccgccgccttcaccgcccatctcatcgtctcctcctctgtgtggacccgccgaccggccggcgcgccttctcccatcagttctatctctctctctcactcacttactctcaaaccgcgtcaattgatctctctggcacgctcttcgctcggcgagctgtattcggtgtcggttttcagtctgcgtctccgcgccccggtgcaatgcatatgttccatcacgttctgctcctcttgttgctccgtgtgctgccgtgttttacgcaatttcaggtaaaattgatacaattgatacaattgataattatcgaagtgtcctctatgtgtactcacgctgttaatttaatggcctaaccacagaattatgcttctttaatttttgaactcgtagctccgtatgttaaatccactatgagattccttgccatgtttttgcaatatttttttgtttgttatgagaaagtgtatgtgttctttgtttggtcacatgggaaccgctggcctgagaatggaaggttttctgggacagagcttttgaatccgatagcctacaatagggccccagtgcaataacggtaggcaggcccgaggcctaatttagtccaaatagtccttattcagtctagatgattcaaagctaaaatcaaagggc