Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y95B8A_84.j   

sjj_Y95B8A_84.jRNAiJA:Y95B8A_84.j
PCR_productsjj_Y95B8A_84.j
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY95B8A.6b Source_evidenceePCR312WS150 Sequence/Annotation Release
Overlaps_Gene Y95B8A.6 Source_evidenceePCR629WS150 Sequence/Annotation Release
Chunk_score Abs_score566
Max_abs_score566Y95B8A.6
Specificity_index0.678
Rel_score1
Map_statusUnique_ePCRI887504889796
Y34D9A.2 Chunk_score Abs_score106
Specificity_index0.194
Rel_score0.286
F36F12.4 Chunk_score Abs_score70
Specificity_index0.128
Rel_score0.189
Overlaps_transcript Y95B8A.6a.2 Source_evidenceePCR493WS150 Sequence/Annotation Release
Y95B8A.6b Source_evidenceePCR629WS150 Sequence/Annotation Release
Y95B8A.6a.1 Source_evidenceePCR497WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y95B8A_84.j2293ctacaaacctcccttctgcctatatgcctacgcacctaactcctgcctgcctatacgtctacctcatgctgaaaacagacctgccttgtacctacctatgcgcctacctaagatttgcctcctacgtgcctggctgcctattttgcctataggcattactgtcagtgcgtctacccagagcctacctttaggtagacgtttgcctacctaaagcaaccgcctacaagtctattcgcctgcctccttgcctacctacacacctcccttatcccggcttttccacctgcctatgcgcctatctcatgcctacccaagacctgcaaacgtgcctagccgtatgcctacctaacttcgcgcctacatatgcctccctttcagatcgagtcaactaattcgaaaaatcataaaaaccggccaaccggcagaagccgaacgtgcttggtgggacgaggaagagtgggaggagggcgagagacgcaggaaacgagccatcgaatggaaggatacagatgatcgtctgctaatgcgaaataccggaacatcacgtcatattttgggtaggtaggtgggtgaacacagcaagtgcgctccatcgcgcgggacacttttcccgcgctttttaggaggtcaaacacggaatttttccaggaatgactgtggcggtggaatgcgatgatgagactggagaatttaatagtggtggatactcgttgtgtactacgtgccgtgctgttcgacacttgccatccacgtattttccacgtgtcattaatgagctgatttgctcgcagaaagcgtgtttgcgaggagaaggaaaatgcatacaacgggttatgccgatgaaggtatgtaatttttttgtttttgcaatggagcgcgtttgtactcactccacgagaatcacgtggtgtcagagtgtctcatttcggattgatctacaaaaaatgcgggagaagagacacagagttctcaactgattttggatgattaagaacgtgctgacgacacatttttatgggcaaaaaattcccgcattttttgtagatcaaatcacttggagaatattatttttatttgaatatgatcctttaaagaaaaaataaaatttgactgaatttcccgccaaaaaattttcgcagaaaatttaaatttcccggcaaaatattcacggatatctggcttccctcataaattgaaatggaagagtttttgccgaactaggccaggccatatctggggtagatttacggcgcgttgcgtgtcgcgtcgcggctcgattttagttgtaaaactaaatatatttgtccgtgtggagtacacgactttcccacgcgttggtgattgtcaatagagtgcgaaaaattcaatgaggaaggccagaaccccgtgaatattttctcaaacattttttttggaattaatgtgcaatcgcgctctaacgcagtatccaaaacttgggtcttttggcgggaaacccgaaaattcaaagttttttgctttaaaatatcgtgaaacagacgaaactagtcgcaaaatttcaaatttacggtcttgccgcgccagtgcggtggatcacgattgcacttaagaaaaatggcgaaaatcaaaaatttggtttatttttggcaactatttttcattctctatcaaattcatactgtacacgtggaaaatcattgattttcccgaaaatttgaataaatgggatgcaagatgcgagcgcgccctattgtgattcgttaaaattcgttagaagcgtcactgaaatcgaaattttttctcgaaaaattgcagtgtgccacgttgtaaaatatcgattttttggaaaatttaatatttagaagtgcggatgcatcctattgtgctccaataaaattacacgggcttctggcattccgcattgaatttttcgcgctccattgacaatcgcccgtgtactccacacggacaagtgcatttagttttaaaactaaaatcgagccgcgacgcgacacgcaacgcgccgtaaatctaccccagatatggcctggcctagttcggcaaaaactcttccatttcaaaatatgaggaaggccagaacctcgtggaaaatatcgatttttccatttccacgtggccaaaggaattgcaagcgcgctccagtgaactcgcccaatttccattttttttcaggttctccgaaacgtgggcacccgcgagtgtgctcgctggcaaatgagccaaatcgacgtgcgaacgtgttgtgattgtatgctcaatccgtcatcaccactggtcacctatttatgagcga