Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y95B8A_85.a   

sjj_Y95B8A_85.aRNAiJA:Y95B8A_85.a
PCR_productsjj_Y95B8A_85.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y34D9B.1a Source_evidenceePCR974WS150 Sequence/Annotation Release
Y34D9B.1b Source_evidenceePCR986WS150 Sequence/Annotation Release
Overlaps_Gene Y34D9B.1 Source_evidenceePCR986WS150 Sequence/Annotation Release
Chunk_score Abs_score860
Max_abs_score860Y34D9B.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI948874951336
Overlaps_transcript Y34D9B.1b Source_evidenceePCR986WS150 Sequence/Annotation Release
Y34D9B.1a Source_evidenceePCR974WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y95B8A_85.a2463cgcaaacctacaaaatgatcttcaaaaaatgcgcgaattttttgcccaacaaaatgtgacgtcagcacgttctgaaccgtgcgaaatcagtcccgcatttttgtagatctgcgtagatcaagccggaccacaaaaatatcaaagttttgaatttttcaaaaaaaaagcacttacgaggatctagtcagcttgaacagcaagtaaataagacaaaacgcgcacatgatgaagctcaaaagtagatcaaacgagaacttggtcgccgagaccgcattgaaacttctgtcaagtgagagaaacggttgggtggcatcgttcacaaatgaaagcatgtagaatagtccagcaatcggatagactgccgcaatgactccggcaaacccattgacatcctgctcatcagagcccagaagccggcagcaagcagacgaaagagcaatggagctgatgaggaatagaatgagctcccggcagaagttgaagatccagtcggtgcccgggcttgctgctccgatgaagcagagtccggtgaggggattggcggcgacggcttttgcgagtagcgcgagcattagtggagccagcgggattcccaggatgagcatgatcacgcgggttctggagtcgtcctggaagatcattttttaaaatttaatttttgaaaatttatcatgtctggaaaaggtacaggctgactagacctatttcacgtggtgtcagagtgtctcatttcgtcttgatctaccatgatctacaaaaaatgcgggagaagagacgcagacttctcaactctcaacgtatggttaagaacgtgctgacgtcacatttttaatgtacaaaaaattcccgcattttttgtagatcaaactgtaatgggacagcacaaaattcaaagccctcaccaatatatgcgatgtccttgtcgccttattccacgacacacagatcaagagccaccagagacgtgagcaagttgccgtgtagtaaatcagtgaggccactgaagaacatggaacatgggaaagccctccgacgacgaagagcaggtgatgggtgtagtcggtgcacgagatttggaacttcaaaattctttttgaatggctcaaaaatattgattttgagccaagttatgaccatttgaagttggtggcctaggattttcctaggagtattctaggccgccaactttggacagccataacttggctgaaaatcaaaatttttgaaatctaatttcacagttgaatttagcagaccatgagcttcaatttgacatatttttgtgccttgccacgaaaactcgcagacctacagtaatccggccaaaattaatgttaactgaaagctcagagtctgctaaatttaaatacaaagttcgatttccaaaatatcgattttcagaaaaattatgaagactctaagttgatggcctagcattttcctaagagtattctaggccgccaacttcaaacgctcataacttggctcagaattaatattttcgagcaaaataaaaagaatttaacataaaatcttgtgatctaccggaaactagatgagcgcaattttaaatatctaggccaccaagtgaaaaccgtgactcggctcaaaaccattatttctgcttcaaccaaaaaccaattcatttattttaattgaaagcccggtgtcggctcaattcaaataccaagtttattttcaaaataccaattttcaaaaaagctatgagcgttctaagttggtggcctaggattttcatagattttctaagccaccaacttcaaacgctcataacgtggcttaaaatcaatattttcgagcaaaataaaaaggatttaatataaaatcttgtgatctatcggagaatgcattttaaactttctaggtcactaagtaaaatattcggccaccaagcctcggccgaaaattattatttctgctgaaccaacaaccaaattctccaaaaactgcttacctgatctttaaacgaaatgctcacaatataaataaccgatgtcgcacaaaacgagatgcacgagaagaacatggcagtttccgtaagtgagtggagcatctcgagacgtctaaagtagatcctgatttgtttttggaaaattaggccacacatcacacaatccaaaacttacgataagccgactatgaagactgatagaattgttagtattacagagctcagcgagagaaacaacaagagtcgggtggcggattcacggtcagtctggaaatgtactcatttgttactgaactaggtctacttaagcctaagcctaaagtaagcctacctgcccaaccttctgtgggttcgagcacaaaggcacacactttgaggatcgattcaggaacacctcatcctgtgggcattttccgttgaggcggtcgacctcccgttgaatatcttctactcgatcattaccgtcgtcctcctggaaaagaaagatgatt