Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZC123.1   

sjj_ZC123.1RNAiJA:ZC123.1
PCR_productsjj_ZC123.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC123.1 Source_evidenceePCR879WS150 Sequence/Annotation Release
Overlaps_Gene ZC123.1 Source_evidenceePCR879WS150 Sequence/Annotation Release
Chunk_score Abs_score838
Max_abs_score838ZC123.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI839837841024
Overlaps_transcriptZC123.1 Source_evidenceePCR879WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZC123.11188acagccggaagactctacgacttccgaagagcccacgttcgagtcaagagaaacatgaactttggaaatggagcatgccagctgtgtctgaacggaactccgctcaagagaaccaagcggtctctcgattgtgttccgtgtacctacctacaaccacaatactctgattggaacccgttcctcggagatcaaacgccacgcggatcgcagtcgccagttggaactccactcgccgggcacagaactaagagagctggcgtgagtttgactcatagaaattaacgaagctaaatttatttttgcagtgccttcctcatccacaatgtaccctgcatgtccgtcgctataagagaaacctgatcggatcccaatattgtgagccatgcaatggacactacggtagaaagaagcgggaagccgagagagatcagtgcttgaaaagagagaaaagatatgcagatgaacagtgtgataacgatgagttcagtatcaatgagcgaagcaaacgacaagcctacaatccaaaaggaattttggatatcgtgaagctcctatccaaggcctcctcaggtggcaacaatccaggaggatgcatgaagttcccagcctgtgttctggctcagaagaagagaagaaagagaaatgcagatcggctcgacacgtactacaaagctgtggaggagcacaagaagctggtggaagagtacgagatggcgatggaggagcacaagagagtcaagcggcagttcttcgctccggataatgctgcatcctgtgttccgtgtccggcatgggtgacacttgccttggctagcagaaagaagagagaagtcgagaaggtggagaagcatatgacgatgagcgaagctatcgcggatatcagagcaaagaaggggtataaggaaggatttgatgatgatgatgaggtgaggactagacctgaaattttagatcctgtaagaactttttgaaaattccaaaaaaaaaaccccctaattgaatcacgcgcgcacgcgccactgagaaggatactgtattcgcggcgagaccacctgcacatctaactcccaaaagtgacgaatttggcctaaaatggactttcttcatgggatttccacagttttcaccatttttttgacacagttcatgactttttacactcaaaaaattattggcgtggtcatttca