Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZC196.6   

sjj_ZC196.6RNAiJA:ZC196.6
PCR_productsjj_ZC196.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC196.6 Source_evidenceePCR1138WS150 Sequence/Annotation Release
Overlaps_Gene ZC196.6 Source_evidenceePCR1138WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV87291098730805
Overlaps_transcriptZC196.6 Source_evidenceePCR1138WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZC196.61697cagaatcatgagtacgccgaagagatgtcatccatttctatcaaaaaactctggagaaatgctgaaaatcagacagtaagaatacgcatatttgtttcaatagttgagttatttcagaggaactcacgaaattcgtagcgagcctgtccaattttcaaaccagcctcctgtcaacccacccgtgaacactcaagttggcttcttcagaaataccgacggaattccaaagcataaaaatcgaccggttatgcccaatagctcgtttcctacgagatgcgtaacctatgtggatgtacttaatctgaaacctcaagttcaattaaagaaaatggaattcaagaaagagagtttaccaccaatgaataacccatcaaaaccacgagaagatcctgtggtgccagaaatattgaaaaaaaccagctccgggatcaaatcggttcagcatgtttctcaaaaaggttagtttcgagtgtttttatattttcgaattcgttttttttagataaacttcattctgaaacaaatgaaggtgttcagccagacattgccccccttgacgatgttcacaggccagttgtagaactcacccagtatctaggctcaaatagtactgagaagccagatgttacaattgctaagaatttggagccctctaaaataacaagtatgttttttttaataaaaaacaattgtcaaatagacaatggtatgaaacattcttcaaaatggacaaagtaccaacagaaacaaaaaaggtttcattgaatacaaaatggattttaactttcagagattgtaaacgaagaaaccaagcctgatgatcaaatccaacaaatttcgcatttggacgttacagcaaaagaagatgttgattcaagtaagtcagaataaaaattctacatatcatagtaaaacttttcaaaaactttcgaaatgtgatttacaaaaactttttattggaaaaactcaaattttcgactagctttatcatgatattctgttacctcagactgattaaaatataactcaattttttcaggtattgaacttgaaaatgaagataattgtcaaatagacgatgacataaaaaatacttcggaagtgcgcaaagaaataacaaaatttgaagaaacagtggctgttcctgatgaaaatgagcaatcgtttgtgaattccagtaatttcgtcgacccgaattgtgaaaaaggttcgacaatttcattaatttcttgaaacaattttatttaatcttcagaaacttcaaatgaagatcaaaaccaacaaaatgatgttgtggccgagggtatgtttcctatattatacaatatcactcataacaaaatttagaaacgatggaaaaacctggtaatttgacaagatcgtttttgaccgaaaataacaggcttcttattgaagaagcttgtttagatggcattgagcattctaacattgttgcagaaataagaggtaaaaaacaattgcaagggtttctttctaaaaagtatttcagaagacgaaaaaacagatgaagtggcttgggaagatttaaatgcaaaagaaaaaacagacgacgaaaatcaaacaaatggtaaattataattctgatattaatacggaaatactttttagataatctgcccgaaaaacaactaacaaattctgcggaagttcctccattgtgtccagatgatgctggt