Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZC204.6   

sjj_ZC204.6RNAiJA:ZC204.6
PCR_productsjj_ZC204.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC204.6 Source_evidenceePCR513WS150 Sequence/Annotation Release
Overlaps_Gene ZC204.6 Source_evidenceePCR513WS150 Sequence/Annotation Release
Chunk_score Abs_score471
Max_abs_score471ZC204.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII16441651645040
Overlaps_transcriptZC204.6 Source_evidenceePCR513WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZC204.6876gagatctcgaataaccccataccaggttagaggcgaagccgagaaccttcgccagctaccttgctaataacttagagcgaattaaccctatccccattcccgaagggctggcgggcccataggcccgctagtcaaactcaccaaagtagtattttccttgttaatatacaaaaacggagttggactcgaagtgttccaccaattggttatgaacgtcgccggttgactggtacacttgatactatgcccaaaacatcctgtcccagcggtgtaatcagtgttctcgggatctgaaacttgcttgaaacacaacaccaaacaccggttagaatagttgacttactcgcgaaaaagtcgggaagaggcttgcaaggacacttcaccgttggagttgtcgttggtgaaagagttgtcgtgttctcccgagccacacgaatgtgctcaccttgcaagacagcaaccggtagaattcgctcttcgagattcttcttctcggttgtggtggaaggtgggacagtggagacttcagtcgttgtggtggaaggtgggacagtggagacttcagtcgttgtagccgaatcaccggctggtagtccgcatccgcagaatatcgagttgattgatagcgacaatacgaagattgtcttgatcatgagttttgtcggtcgaaaaatgaactaactgattgaaattgtggcttttatggcagtgcttgatatgctaatgagacagcaagagaatttaaatgagatggtaattgggggttgccttgaacgatcagttcagctctgcaaaatacggaggggattcgtaccccagcgcaccccaatccaaagctcaacaggctccgtgagtcctgagttggtttctatgtgc