Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZC247.2   

sjj_ZC247.2RNAiJA:ZC247.2
PCR_productsjj_ZC247.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC247.2 Source_evidenceePCR710WS150 Sequence/Annotation Release
Overlaps_Gene ZC247.2 Source_evidenceePCR710WS150 Sequence/Annotation Release
Chunk_score Abs_score647
Max_abs_score647ZC247.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1025854910259576
Overlaps_transcriptZC247.2 Source_evidenceePCR710WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZC247.21028agcgattaggtccgctaacacaaaattaaatttttctgagaaactaaaaaaaatccatacctctccattgaccatgaacttctgctccataatcttttcagtcaatttctttctgagttctgaagcacttcctccatcagaactatcattcgatggaccagcttcttctctttctgactttccatttattacagttttcatagattcagacgaagcaattgttgaaaactcaggtttcggtaagtcattcaacggtgaaatttcgcgttctgtacttgattcgagcttctcagttggtggcttcttcttgacaagacggacctggaaacttgtcatctgaatggagatcttctcattgaaacccgatgatcttacctttctctctccatcttcaggtgatacatgtccattcatcgtaccatttccatttacaactgaagttccatttgttccatttgtactcccatctacaggcgttctctttttgatcacttttcggacaactttcacttttttcggtgccggaatggcaaaaactttggtaaccggtacaatccataatgaataattggttgcatccgatacagaagctgttggtgaactgaccatagatgattgttcagttgagtctggtgtatcttcacgtcttgctgagctcagcattccatgcgatgacgaaagaatatggtatgttgcttggccctaaaaatatattaagtcttaaaataattgtcaatagaacaaatgcttatcaattttttttgttgaattcggatagttacaaattgtccatgagtaggcggaaactgaatttttggcaattttcggaacttggcaataattgccgattgccaaaatttcaaaaacctacctaacattttgaaaaatctttaaaaaacaacgaaccgattcaagttcagtgatgaaaaatgcccatttgttaggataaactctggagaacaacttgacaaggggcgttttccaatcttttccggcgcccagaatcaattccatacaacatcccggtt