Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZC308.3   

sjj_ZC308.3 RNAi JA:ZC308.3
Simmer:ZC308.3:Screen_A
Simmer:ZC308.3:Screen_B
PCR_productsjj_ZC308.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC308.1a Source_evidenceePCR853WS150 Sequence/Annotation Release
Overlaps_Gene ZC308.1 Source_evidenceePCR917WS150 Sequence/Annotation Release
Chunk_score Abs_score770
Max_abs_score770ZC308.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI63698096371445
Overlaps_transcriptZC308.1a Source_evidenceePCR917WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZC308.31637tggaaattctaccgtacgccaaaagggttttttttcttcacagcttaaaggcgcaatacctgacacagtgcatgggtctcgccgcgagatacggtaagcgagcgccaacgccacgcattgaaaaggcgctgaaatttgatttaaacttcgcttttcagctcgctttctggcagtttttccgacgatttccgtcggagatatccgtctaattttgtcgccaatatggttatggctcaacagcagaaaaatgcagaacgaaacggtgagcaatctgagttttcaatcaaaactttatttgaaattgagaatcgatttttgagccaatctcaaccttctcattcttttaatttatgatttatcttttcagacgaacacactcgacgcaacagatctccttcagtcgattcagtaagccgtgtgcagcagcaaagtgggggctttgcattttataatcagcagtcaaaccatcaatatcagcaatcgcatccacgacgtacaagcttttcgagggatgggaacactggatactacaacaaccattcaggaaataaaagacgtcagtcagaaaaattattgacttgctaccaaattgttcattttcagaaacctacaataaccagcgcggcggacgcagttacaatcatcgcgggaatagcaattatcaacagaatggcgagtattctgggaatcagggatgtgtcccaaaatatcatcaaaggaatcaaaagtagaaaatcgaatttcgtttttgctattcctattaaaatcggtatttcagttaccctcaactgcaaccaaagtattcctacttccaaccacatcagagaccaatttttaactcgacccagggtaggaaattgtgattgacataattttagattaatagccttacatatctcccctaaaataataatctgaactaatatgaagaataaataaatttttttcaggttacggcacatattctgtccgtcggtcatcgccaccatctccatcagctctatcaagctcaacagcgaattccacatcaaaccgagctccgacgcagcctccaatcctgctcaggcacgctgagccagctagtgataagaatcatcaaggaagcgatcatgagcaaaatcatgatcctaaaattcatttgtacaggtcggctggcaccgcaccgggtggatatactcaatggtaaatttgttttccaggcctgtatttcgaatttgaaggtttctcatttgatctaccataaatgcccagatggtttattgcttcgaaaagagtggcattttttggcggttgtgttttgggaaatgataattaaattttacaggagaatttttgagcctttgtattttatctaaatctaatttcatctcatctaaaaattataatttatagcccatctccgtacaaacagccaccaccacaacctccgtctacaccatcatcttccgataaacggattgagcagcaacaagcagaggattggccgacgcggtttcaacatcctcctccacaattcagacgcggtgagtgttatttttttcatttaaaaattttctaagtaatatttttagggcaggatccaatgccagcctcaatagagctccagcataagaccgccaatcaaacgatgccagttg