Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZC328.1   

sjj_ZC328.1 RNAi JA:ZC328.1
Simmer:ZC328.1:Screen_A
Simmer:ZC328.1:Screen_B
PCR_productsjj_ZC328.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene ZC328.1 Source_evidenceePCR604WS150 Sequence/Annotation Release
Chunk_score Abs_score520
Max_abs_score520ZC328.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI64031726405597
Overlaps_transcript ZC328.1.1 Source_evidenceePCR604WS150 Sequence/Annotation Release
ZC328.1.2 Source_evidenceePCR602WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZC328.12426atccaccaaatctttgtaaccctagcaatcgtaaacaaaaaatgtctgaaaagttgtattgcagccatactacgagaagaatgacggaaacaatccacaaaccagataggttattccatttgaatttccatataattttcttattccgagcagtagaacctattcatttcacaatttttaaaaagtaaattgaaatttcagtacatcaatgttttactgaaagtatacaaggagaggttctctttatttttgtatatcctctgaaaacgaaaatcaatgctacaaaaatatgccatcctgttcaataattttaataaatacaattcgagaaaaacacgataattcaatttattattggtcgttttgcgatttttttttgacatttcacaaatactacggtagttctacatatttccgacataaatataaaatatagtcagtgggggctttgcctaacaagccaagtatttcagctgacaattagatttttgaatgaaaactatgccatttgatagtgttttcactgtcggcgatttttttacaaatttgaaagtgtttatactgaaatcttttgcagacaagttcatgaaatttgtcatgtaacacgaatcttttgcacataattcgcaggtttccagatcacttgtggtatttcatttatgatatgcgatgacgccataaatacccttgtacttcattcattctccgcaattcacaaatcggatacaatccctctcacacaagcgggtcattttcttatttctctcgatcctccacttaatctcaatacaatcggaacatctcttctctggatatctagggcaacacggacaattgggaaaaggaaaggaacgagaatgcgtttcgggcaacagacacaccattcgtctttcactttgatccatatatttccttatcgatttttttgaagtggtattcaattttttttaatgtttttctactgattagtgaatttttaagttcaacacacttgcgaaagccagctcaataagtcgaaaatattaatgagattttcatccaagttttgataagtgctttctatttcacaagaaaaccaaattataatgttttttattgatttctatataacatgtgatcttttgtaattacaaaccagtaacttcaagctcaaatttgtaaaaatcttgtattgcctgccatattaatatgtagaaaaaatacggtaacttctccgcttttcattaggtacatttaaggtcaatttaaacattttataatcatctcacaatcagtttggaacacttaaacccaatgggaatttttctgagttaaacatttccactcaaagattagaataaatgtttcaagcccttattctgacgaagcgttccacatatttcttttttttgaaatttgatttctataacatttacagtaaatcatgccaaacgaccgggtggctccattgcctccaaactttgtatactctccacatgacaaattctactatgcccctgccacgtgtaattcaatgcattatacaactgcctcgtacatttctgcatttattgaattccttgttatgggaactggagctatttgtttttacggttagttgattggaagttcagaaatagttgtatttcacaaaacttagaaattaaagttttaagaaaacaattttcagtaatgagccacaaatcggattcaattggaaaatggttgttttatattcaagctggtattacggtactttctcttttaacaagtgctctaatggcatttggactttggaaagaaaatccacagatgctaggatcaaaattgaaatttattgaagtaagtcttcccttcattccgaaaagtttccggctactttaattattctataaacttttaattccttattaaatttcagtttataatctgtttcctcctgatctgggcggtcatttctattgtttgcatggcctttggaattcaattcacaagacaagtctttggaatatttggaaaagttcatcgaattgaacaagattacggaccaatttggccattcaacattgctgttgtttctttcttcactgctgcaattgctatttggtgagaattaaaatgcctggattttaatagattaactttaattaatttataattctatgttatgaacctaaaacatgaacttccatggtttctatagttttctaagaatgcgaacttttctctaatagattttgaaactcccaataaaacaaatgttgaaaatgagtttcaagtttcaaaactttctttcagaagataacatttaaaaaccattgatttaaatctgtctgtataaactgtttactttacaggacaagaatcatcattcaaggagctgctgattatctctacgataaagcttacttcgcagacaagcagaacgtcgaactcagagagtcatc