Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZC328.5   

sjj_ZC328.5RNAiJA:ZC328.5
PCR_productsjj_ZC328.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC328.5 Source_evidenceePCR576WS150 Sequence/Annotation Release
Overlaps_Gene ZC328.5 Source_evidenceePCR576WS150 Sequence/Annotation Release
Chunk_score Abs_score513
Max_abs_score513ZC328.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI64057426407399
Overlaps_transcriptZC328.5 Source_evidenceePCR576WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZC328.51658tgtgttttgttacgtttctgtgctcatttgagcattaaaaacattcaattgttattattgcccaacaaaaatcctgtaattcacgagttaaaaatttaaaaactaccaattctcaacattttgaacgcgacacaaaactttattagaaattgagtaaccacgaaagaatacttctctttcttctcttatatcccatggctggatctttaacactgagagaataattatcgaaaatacttttgaaaagccaataagatccaccatctggatagtacattttctccttcgtatttgccaattcatcaattgtagcagtgtcacatgtgaccgtcccgttgagatatagctgaaaaataatttttaattttaagatatgtatatgctatagctcagcatcagtgcttcagaaggccggctttacctgtttccgaacatttgcggtcctgttttaaaatttttcaaaacaggaagacctgtctaactccctacgttacgtctacctaggtgccttgcttgattctcagctcgtttctgcttacgttctttcgtcatgcctacctacctcctatatgctagcgtagcgtatacctatgtacctcctgcctgcatcatgcctatcccaggcatgtttactacctacatacgtgtcgtttagtggctgtcgtcacagagtttaatcccgtattcaccttgaaaataagtggcatccctccattcttcacaaaatcagttggtctaaatctctcgaaagcgtaacacttgttagttttaaagaaactgtatgcacatttcacatcagtttcacaagttttactacattctggtactgatgctgcagttgtaactcccattgcataatcttcaaaaccatcttcttcttctttcatattctcaaatactgccatacaaggtgcttttgaatcacgagttgttgaactctccactgtagttgttgatggtggttcagtggtcggacgtttggctcgacatggctttgcgcccttcaaaaacaaatttattggaaatatttatagcggtaatagaatttaaaaaatgacaaaaattcaagttttgaaatgcatattaattttgttgaatactactgtaaaaccaaaccaatcagttttaaatgcctacctcgccaatgtttatcgccgctgctagtagagccaagaaagtaaagatttgaaacctcatctcgttcaggttcagaataatgtttcattttatgttctaaaatagtctcacaagttatgatactcataaaacatgagaacttcaataagtcagtcgtcatagttttcaaatagggaagtgaaaataggaacgaacaaagaatacagtaatgtcaagagttttgagacagtttaaaagaacttcattgcttaattgttactgcaataaccgaacttttaagaagcaatatagatcactcactatttaagatctagaaaataagttccaagtttaaatttctagtcaagacgcaaatttttgctgtcttggaatttggcgtggagaaagctacaacgttttagtcaatattttggttttcagctaattatcgctcattttatttctatttcttgagttgaattttttgcattctcaaatagcgcatcctcaaaacccaaattcctcaacgttgtatggtctct