Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZC334.3   

sjj_ZC334.3RNAiJA:ZC334.3
PCR_productsjj_ZC334.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC334.3 Source_evidenceePCR312WS150 Sequence/Annotation Release
Overlaps_Gene ZC334.3 Source_evidenceePCR380WS150 Sequence/Annotation Release
Chunk_score Abs_score338
Max_abs_score338ZC334.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1403121614032231
Overlaps_transcriptZC334.3 Source_evidenceePCR380WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZC334.31016gcgtctgtaaagaaaaagcaaaagagaggtatagggataaagtttgtgagataaaaaaaaagagatctttagaaaacgaagccagatgggcagcaggccgagatgaagccggcatcggtgtacccagtactgcaggatttgatggtaagatctgaaagactcgagctcatctagactaactcaaaggaacccaccgtcgttctgaattgtgcatccgcccgcgcaaagcttctgcaccttcatcatcattgatcgtccgcacgctttttgaggtccctggttggctcgaatgagtcccatctccttgaggcttttttcaagcgcttggtagcttttgagctccaaatccgcgggctccgagaagacatggcatagtgccaggggcactaggagcagaagaagaaacaaggtgggagatctcattctcacgaaaaatgagttgtcatataagtttgtgcggtttttatatcgatgagagggcggagtcatggtgcagagcatctggctgaaatttggtgtagctatctgacttaggctaagaacctcaccaagacaaatcgggacccatcagagctagcaaaagtgcagcctagtacgatttgctatctacacagccaacagagcctaacaaattgtaagtgtgctagggttttctaagtttaagccacaaagagaagtcctacttttctgggtggctggggctccaggtaggctctgcagatcttactcaggtactgaacaataaaaatgcaactatccgatggcaaacacgaccccgcacaaagttgataccgcccgaaatttgacaacactttttgctcgttttcgtatttttttgcctaaaacatgtagtgactataaaccaagaaataagcaaagtacaacattcccaagagcccgcgtcatagttgatttggtgaataattccatatatagctctttcgatacagcaattctcaattgtttaccactacttcaaaatgtcttctgatcttacaaacgtagtcagaacgggt