Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZC434.9   

sjj_ZC434.9RNAiJA:ZC434.9
PCR_productsjj_ZC434.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS ZC434.9a Source_evidenceePCR1119WS150 Sequence/Annotation Release
ZC434.9b Source_evidenceePCR1119WS150 Sequence/Annotation Release
Overlaps_Gene ZC434.9 Source_evidenceePCR1119WS150 Sequence/Annotation Release
Chunk_score Abs_score930
Max_abs_score930ZC434.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1035675910358427
Overlaps_transcript ZC434.9a Source_evidenceePCR1119WS150 Sequence/Annotation Release
ZC434.9b Source_evidenceePCR1119WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZC434.91669cgacgaagatcgaatggaatggcttgattccgttctgaaaaactcaaatatcagctatgacgtcattattgaagacgttggaaagttgattctagaaaaggaacatggcccaccgagattttcaaatttattattttccaaaagaatgcacaatgaaggaggaaatcgagcaagggtaaaaataataattacagatttttgtatttaactttataatttttatcacaatttttaaaataattttagtacggatttggagaatatcacagttatcaaacaatttgtgactggatgaaagatatcgaacgaaaatatccggataaagcaaaagtgttcacaatgggaacaacatccgaaggacgaccgattcaaggaattaaaattggaagtcaagtatggagaaatgataaaagaatattctggattgatggaggaattcatgcaagagaatgggctgctgttcacacagcactttggtttattgacagggtaagacacagaaaaatgccgatcagaaagccgatttgagatattgtctgagaatttagaaagacagtttacaaaaagagcacgggattaataatatggaatgattcttaggcatatctcaatttttccagctaatcgccgattacaatgatgattctttggtccgtgctgcagttgatcgcctcaacttttatattcttcccgttgctaatccagatggttatgaatactcgagaagtgatgtttctccgatggtactgatccaaaatgctaactcctgttctttttgaaaatggaaatattgcagattcgtttatggcgtaaaaaccgtgctggtgtagtatgcaagaaggatcgttggttcagagatcgttgctgtggaggtgttgacttgaatagaaattatgattggcattttggaggttaagcttttgaacttttgaactgaaaagaaccaggataatgttcagaaaccgggtcaagcacggacaagtgctccgagatttaccaaggaagttcggcattcagtgaaagtgaaacaaggctagtttagaagttgtaacattttttacaaattatattttcagatcaatgagagatttcctaacatcttcagagcttaacgggaagatcgatgcttttataactcttcacacctactcacaaatgtggattcatccgtattctcatgcacgtaaaagtgttccagctgatgttgctgaattggtatgtgttgatgagaacaacgtagtaatttgtgctcatgccaaaattacagttttgcctttagatctacaaggcttaacgctgagttctgtgtacctaccaaatgttttttcagcaacgcgtcggaagagcggctgtcgctgctctggaaaacacatacggaacgaagtacaagtttggcacaggatctgatattctttgtgagttaccacttagtttagaataaattaaatctgaaactgttaaagatccatctgctggaggttcggatgattgggcaaagggaactcttcgtatcaaatatgtatacttgctcgagttaagaccaggagaggatggtaattattcataaatttgagatttttctttcgtgccagttggtttagattaatgtgttttcagtttgggatggtttcatccttgaccaacatcaacttatcccaaccgcaaaaga