Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZC581.4   

sjj_ZC581.4RNAiJA:ZC581.4
PCR_productsjj_ZC581.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSD2092.1b Source_evidenceePCR140WS150 Sequence/Annotation Release
Overlaps_Gene D2092.1 Source_evidenceePCR140WS150 Sequence/Annotation Release
Chunk_score Abs_score86
Max_abs_score86D2092.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI66339146635553
Overlaps_transcriptD2092.1b Source_evidenceePCR140WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZC581.41640ttaagaaattgactgccggaatactaataaaagctgcaattcgttagttttcaaaataaagaacggtttgaaaataaccgacaatctaaatttcgataaaatccggaatgctttttatccagaattttcaaaattcgatagtttgccaaaatatcctatgcccgtgcaccctgtgaacttgtcaactatcaaaataaaataaatactcacattattttccaaagagtattgtggttttagcgacctgaaaaacgttaaattcgtttaaaaaacttttcttttgaaagtgtaaaagctcactttgtaaatgtaaaagtatcaaatattcttctaaaccggaatcctggagattttcgtggagacggatgattatgattttgatggtttttctcggatgtagaggtccctggaataaaacgagtttgaaaaattaatatcgataataatttttaaagactaaaaattttttttaaactgaaattgacagatttttgtacaaacttctgattcgatacgagagaaaagtgggctctcgtcgaatttttcgccgtttccttcgacgaaataccacaaatatgcgagcgagtgtggaaattcgcattttctgaaatagaaataatcaactgatattcagttaaaattagtgaaagcagagtttcaattactcagaaaaggttccatatccactatatatatatataatatgggttgactctagtacactttcgtacggtatgtagtaattttctatttgcattttccccagtgtgccattctaaacatttttggaaggaaaaaaagttttgaacgttctaaataaaggcattcttaaattgggattattcaaatttacatttaaaattacgggagggagtaagaattgaaaataagctcctaatttttatccatttctctctacattttttagacttttaactaatattctcttttaaaaattgacttaaaggtcagtggtggctcagtctagagcacatatagaaatccatttaaaatagtccaaaatgaccgaatatcatgaaaaacaaatctcaagtttagatttcttataattttcaatcaaagttttggtaaattgccaaatttccaaaaactgtggatttttagtagttttgagcatttctacaggttttcatcaattttcttattgtcaaaactctaatataaagacaaaagctttcagttgtttaattttttctttcaatcggaaaacgtgggaaaattttatgaataattggaaactaaactcaagaaatcctaaaatattcaatatcaaacggtttcttaaaaactgtaactaaagtgacagagacaaacacgaaaaatagaaaatggagagtcaaaatatggggttgttgaaaaaatgtttggggaaaatggaaggggaaggatgtgattgttttctctgcatctttccatctagaattgatgctctgaccattcaccaaaacattaaaaataacattttcaagacattccgtcacataaagttgataaaaatggagggatgtgacgaagaatgtgtaacatcttcttgttatggagtagagcatactaatttgcttttagatttcagacgcagatggtcagaggatgtggggggtaattttaaggaaatgctg