Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZC581.7   

sjj_ZC581.7RNAiJA:ZC581.7
PCR_productsjj_ZC581.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC581.7 Source_evidenceePCR891WS150 Sequence/Annotation Release
Overlaps_Gene ZC581.7 Source_evidenceePCR891WS150 Sequence/Annotation Release
Chunk_score Abs_score754
Max_abs_score754ZC581.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI66606506661843
Overlaps_transcriptZC581.7 Source_evidenceePCR891WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZC581.71194cattccttttggagtcggaagccgatagccagcccgagttttttgctgaaaagcagaggtacgacaaacaataggatataaattactaaccttcaccatataacctttccactcactataaggggaatcatatggcacttcaaagaactcccacatagttattgcaaacgcgaagatgtccgtattgtcacgtgtctctccattatcccaaacttctggtgccaaccaacgggtattggttggtttgttcaagtcgactttgtagattgacgtggcacggcacattccaaagtcagcaattttgacgatttccttgtgaatgagacagtttcgagcggcaatgtcgcggtggatgcatctgaaaaagtagattacagtgaaccagttctttggaagtgaggaaaaaaccacaaaaaatctctcactatcatatcacatgtcttgggtgaaaaatcagaaagaaactaacttcttcttgtgcaagtactctatcccacatgcagcgtgataagtgtacatgatccttgtctttgtgctcaacttggctcccttttccactagtttatcctctaccgatccaccgttacaaagctccagaaccagcaagtatggaatatcatcaacaatgtatccatagaactttacaatatttggatggtcatagagttgcataactctcgcttccttcatcatctcggctaatgattcttcgtcgtttccttcagtgtcaagtttttttacagcaattttggtattgttcttggtgagacggccaagatagacggttccgtaggctccactaccaagctgaaaattaaggttttcaggtattgaagcctctttcattaataattaataccttctttttaaagtccacatctttatgcattaattggaactttcccttgggaatcgcacgtttcaagatcacccgttctcctttgatttccatagtttctttttgcattgagtcaaccagcttcccaatattaggagctgattttccctgaaaacaatattaaatttgttagttagaagtacggtgcatgcataccccaatctttgcagaagtcggattccgtttgatttcgaaacgacgtattccttttttcaaacgaacagccaagtagagttgctgaaataaattcacttttgaagattatttaaactaaattggcaaaccattttgttcaa