Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK1025.2   

sjj_ZK1025.2RNAiJA:ZK1025.2
PCR_productsjj_ZK1025.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS ZK1025.2 Source_evidenceePCR780WS150 Sequence/Annotation Release
ZK1025.8 Source_evidenceePCR780WS150 Sequence/Annotation Release
Overlaps_Gene ZK1025.2 Source_evidenceePCR780WS150 Sequence/Annotation Release
Chunk_score Abs_score675
Max_abs_score675ZK1025.2
Specificity_index0.464
Rel_score1
Map_statusBest_ePCRI1144971511451400
ZK1025.8 Source_evidenceePCR780WS150 Sequence/Annotation Release
Chunk_score Abs_score675
Max_abs_score675ZK1025.8
Specificity_index0.464
Map_statusBest_ePCRI1147001011471701
Y22D7AR.1 Chunk_score Abs_score105
Specificity_index0.072
Rel_score0.156
Overlaps_transcript ZK1025.2 Source_evidenceePCR780WS150 Sequence/Annotation Release
ZK1025.8 Source_evidenceePCR780WS150 Sequence/Annotation Release
WB_DNA_text sjj_ZK1025.2_11686cacatttctctttttatcgccactcaatcaatgtattttgtagctaaattttaaaattttgaattaaaaagcctgacggagaattagattccagaaaaattatcacaaaaaggttcaaagttacaaggttcatttggagaattttttcaaataagaaattgagttaatatcccgatattccgggtctaaaacgcttctgtcaaacgggaaaagaagataatcgtagaggtagattttgtgcaggtattcacgaacaatcggatcttctcgaacttgcttttcagcttccagacgtttggtccatttgtgagtagagtgagcagtctcggtagctgcaaaatttttagaaaattttttaaaaaattattagaataaattattagaataaagtattagaataaaaaagaacctactcaaaatgtctttataaatttgctcaactaaagtgtcacggacgccttgctttcttaagatatctgctaatttagcagccgacgaaatccgatctttgaggtccgagtccataggcagcagctcccagttctcaactccctcgttgaatttacagttcctagaaaaaataaaatcttaaaatagtgctcaatccaaaactcattatttggtttttctgaatttaagacttagcctaagcttgtggctgaacacaaaccttagacttagcccaagcctaaaccttggcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagccaaagcctaagccgtaaacatcgccggagtattggattgagtactttttaaagaaactttacagaacaataatctggtcgaaaaatttctactgatatacttagccgtgccacaataagatctcactcaccaagtcgttggagcagcatgtgcctcaacatactcaattcccgcagctttagtctcattattctgaatctcgacgaatgactcgtaggttttcttcgcgatacaccgcatatcggtttcacagtcgaaacaccgtttttcacttaaaattatcagtttgaactttgactatttcagaatttgcaactaacacgacacatttgttcaagtacatcgacacaaaacggcgaaacggatcccgcacgaacacaaatcgcactgcgtccttatcgttcttcaatgaatcggatggagtcacaaagtttgtctcactagtgcatttcctggaaaaaaaaggtgaggcattgagttcctgcacactacctacctagtacttgtctcccaagtattcgtgaaattgtttttatcctgtaggtactgcgtttcgttgtacaagaggcacatcatgttgagcgtcagctgagacatagacttccggatttcgcaggcaataagcttgttgtccggagccgtctgaattatagtttaagcaagattgcgtgcctggcccctgcttaaggttaagttaaggcttaggctttggcttgggcttaggcttacgcttaggcttaggcttaggtttaggcttaggcacatgcttaggtttaggcttaggcttaggctttggcttgggtttaggcttaggcttaggcttaggctgaatcttaagctgaggcttaaacatgggcattgggatttccgtgggatttccaaaaagcttccacattgtttgttagacc
sjj_ZK1025.2_21692ggtctaacaaacaatgtggaagctttttggaaatcccacggaaatcccaatgcccatgtttaagcctcagcttaagattcagcctaagcctaagcctaagcctaaacccaagccaaagcctaagcctaagcctaaacctaagcatgtgcctaagcctaaacctaagcctaagcctaagcgtaagcctaagcccaagccaaagcctaagccttaacttaaccttaagcaggggccaggcacgcaatcttgcttaaactataattcagacggctccggacaacaagcttattgcctgcgaaatccggaagtctatgtctcagctgacgctcaacatgatgtgcctcttgtacaacgaaacgcagtacctacaggataaaaacaatttcacgaatacttgggagacaagtactaggtaggtagtgtgcaggaactcaatgcctcaccttttttttccaggaaatgcactagtgagacaaactttgtgactccatccgattcattgaagaacgataaggacgcagtgcgatttgtgttcgtgcgggatccgtttcgccgttttgtgtcgatgtacttgaacaaatgtgtcgtgttagttgcaaattctgaaatagtcaaagttcaaactgataattttaagtgaaaaacggtgtttcgactgtgaaaccgatatgcggtgtatcgcgaagaaaacctacgagtcattcgtcgagattcagaataatgagactaaagctgcgggaattgagtatgttgaggcacatgctgctccaacgacttggtgagtgagatcttattgtggcacggctaagtatatcagtagaaatttttcgaccagattattgttctgtaaagtttctttaaaaagtactcaatccaatactccggcgatgtttacggcttaggctttggcttaggcttaggcttaggcttaggcttaggcttaggcttaggcttaggcttaggcttaggcttaggcttaggcttaggcttaggccaaggtttaggcttgggctaagtctaaggtttgtgttcagccacaagcttaggctaagtcttaaattcagaaaaaccaaataatgagttttggattgagcactattttaagattttattttttctaggaactgtaaattcaacgagggagttgagaactgggagctgctgcctatggactcggacctcaaagatcggatttcgtcggctgctaaattagcagatatcttaagaaagcaaggcgtccgtgacactttagttgagcaaatttataaagacattttgagtaggttcttttttattctaatactttattctaataatttattctaataattttttaaaaaattttctaaaaattttgcagctaccgagactgctcactctactcacaaatggaccaaacgtctggaagctgaaaagcaagttcgagaagatccgattgttcgtgaatacctgcacaaaatctacctctacgattatcttcttttcccgtttgacagaagcgttttagacccggaatatcgggatattaactcaatttcttatttgaaaaaattctccaaatgaaccttgtaactttgaacctttttgtgataatttttctggaatctaattctccgtcaggctttttaattcaaaattttaaaatttagctacaaaatacattgattgagtggcgataaaaagagaaatgtg