Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK1025.5   

sjj_ZK1025.5RNAiJA:ZK1025.5
PCR_productsjj_ZK1025.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS ZK1025.5 Source_evidenceePCR327WS150 Sequence/Annotation Release
ZK1025.7 Source_evidenceePCR386WS150 Sequence/Annotation Release
Overlaps_Gene ZK1025.5 Source_evidenceePCR327WS150 Sequence/Annotation Release
Chunk_score Abs_score252
Specificity_index0.398
Rel_score0.661
Map_statusTop50_percentile_ePCRI1145373011454570
ZK1025.7 Source_evidenceePCR444WS150 Sequence/Annotation Release
Chunk_score Abs_score381
Max_abs_score381ZK1025.7
Specificity_index0.602
Rel_score1
Map_statusBest_ePCRI1146684011467680
Overlaps_transcript ZK1025.5 Source_evidenceePCR327WS150 Sequence/Annotation Release
ZK1025.7 Source_evidenceePCR444WS150 Sequence/Annotation Release
WB_DNA_text sjj_ZK1025.5_1841ttgatatctgtgaaacccattccccaggaaagttccttcataagtccacctacacaaaaatggcaaatggcactgttctacactttcggttcaatgtgaagcaaatccgagcgaaaattgttcgaaagtcttatcgatttttcccaaatgacacagctgggcatattaggaatatgcatgatacggtaggcgttgggagtcagaggaaaaaatatcaatagaaaaaaaaaagagattttcagatgaacaagattttcgaaaattcaccacctgcattttcgtacaagccaattgagactttgaataagtgcatagccaaagtcaagtaaggatttgttaataaaaaattcacggtcacaggagtggaaatagtttctaataggttttgatctaccaaactctaaagttgcggaaaatagaagcgctgaagtattttctgaaagttcgccgtgagcttagttttagagcctcgcagcttaaaattcatgaaaaatcgtttcaaaccatgggctatcgaatgaaatagttaggtcataaatttgtacaagctcggcaaagttttcagatccgacgtatgccatagcactggtggaatctgcaaagctgcgatggataatgtcaccaattgggtatacaacacgactgaaggattgttcacaacgggtacacgtatcatcgtctaatctatgtatctcatatttttgctagagaagtattttagttttgtttttgaaataaaaataaaaattcacatttgtcaatttattgttagtctttattttcaggagtgtaaagtttttccagctaatttgaatgaattgagttgagaagtagggttcca
sjj_ZK1025.5_2841tggaaccctacttctcaactcaattcattcaaattagctggaaaaactttacactcctgaaaataaagactaacaataaattgacaaatgtgaatttttatttttatttcaaaaacaaaactaaaatacttctctagcaaaaatatgagatacatagattagacgatgagacgtgtacccgttgtgaacaatccttcagtcgtgttgtatacccaattggtgacattatccatcgcagctttgcagattccaccagtgctatggcatacgtcggatctgaaaactttgccgagcttgtacaaatttatgacctaactatttcattcgatagcccatggtttgaaacgatttttcatgaattttaagctgcgaggctctaaaactaagctcacggcgaactttcagaaaatacttcagcgcttctattttccgcaactttagagtttggtagatcaaaacctattagaaactatttccactcctgtgaccgtgaattttttattaacaaatccttacttgactttggctatgcacttattcaaagtctcaattggcttgtacgaaaatgcaggtggtgaattttcgaaaatcttgttcatctgaaaatctcttttttttttctattgatattttttcctctgactcccaacgcctaccgtatcatgcatattcctaatatgcccagctgtgtcatttgggaaaaatcgataagactttcgaacaattttcgctcggatttgcttcacattgaaccgaaagtgtagaacagtgccatttgccatttttgtgtaggtggacttatgaaggaactttcctggggaatgggtttcacagatatcaa