Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK1025.7   

sjj_ZK1025.7RNAiJA:ZK1025.7
PCR_productsjj_ZK1025.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK1025.7 Source_evidenceePCR837WS150 Sequence/Annotation Release
Overlaps_Gene ZK1025.7 Source_evidenceePCR837WS150 Sequence/Annotation Release
Chunk_score Abs_score774
Max_abs_score774ZK1025.7
Specificity_index0.773
Rel_score1
Map_statusUnique_ePCRI1146614311467302
ZK1025.4 Chunk_score Abs_score60
Specificity_index0.06
Rel_score0.078
ZK1025.5 Chunk_score Abs_score167
Specificity_index0.167
Rel_score0.216
Overlaps_transcriptZK1025.7 Source_evidenceePCR837WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK1025.71160atttgccattgaggaaatcgggaaaaaatacgagcgaggcctcactgtatgcctacaaatcgtctattactattctcaatggcaaaacgtaatcttatacattgaagcctggcgggctcagggagcaactcgttttatagttttttatcattcatccacagaagacaccaaaaaagttctggactactatgaaaaactggggcttattgagctacgaccctggcccaacattggcgagctctcttcaaatatttccccgatgtacccaaaagttgatgaaagtgtgtttattattgcaactcatatggctcttcaaatatgttctctggaaattaagacgtctttgggtattgttgcggatttcgatgaggttatggtacccgataagggtactgtacttgatcatgcgatgaaggaaatgaccgggaaggatattggagcattgttgtttgaaaatacacatgttgcactgacgcctaatatttatacgaataactactcaggagtgaggtcactgacgttcaccgatattttcgcaccgcccaaggtaatatttgctgcggggtttaggcttaggcataagttcaggctaaagcttaggcttaggtttaggcttaagctgaggcttaggcctaggtctaggaaaatttaaaacttcaatcctacacatttcagtacatcttcaacacctctcttattgatatctgtgaaacccattccccaggaaagttccttcataagtccacctacacaaaaatggcaaatggcactgttctacactttcggttcaatgtgaagcaaatccgagcgaaaattgttcgaaagtcttatcgatttttcccaaatgacacagctgggcatattaggaatatgcatgatacggtaggcgttgggagtcagaggaaaaaatatcaatagaaaaaaaaaagagattttcagatgaacaagattttcgaaaattcaccacctgcattttcgtacaagccaattgagactttgaataagtgcatagccaaagtcaagtaaggatttgttaataaaaaattcacggtcacaggagtggaaatagtttctaataggttttgatctaccaaactctaaagttgcggaaaatagaagcgctgaagtattttctgaaagttcgccgtgagcttagtttt