Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK1053.5   

sjj_ZK1053.5RNAiJA:ZK1053.5
PCR_productsjj_ZK1053.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK1053.5 Source_evidenceePCR798WS150 Sequence/Annotation Release
Overlaps_Gene ZK1053.5 Source_evidenceePCR798WS150 Sequence/Annotation Release
Chunk_score Abs_score693
Max_abs_score693ZK1053.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1323517213236582
Overlaps_transcriptZK1053.5 Source_evidenceePCR798WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK1053.51411agctcgatgagccgagtaaaattattgagtagtcagtaaactcttttatctattttttctatttttgagcaccaattttgtaacaaaatgaaatttaagaattcggaccaatctttgcttagttaagcgcaatttcaaacaatcagcaacccgttttttataagtttcagattcgaaataatggatcaactattttataatggaccacctgattacgttgaaattgaagaccgagccataacaactgaaccaggagcttctatacaagcagctcccggagcaatttggatggaagcacttccagcgattgagggaatcccagcagggttggaataccttgcctacttggacacggtcatggtgcatcaagtgaaggaggttcttgagattcttactggatgggagagtaaaaataagtatgctattagaaataaaaatggacagcagtgttactatgcgttcgaagaatccaacgcttgggagagacagtgttgtggatcgcaacgaggttttacgatgcacattgtggataattttaacaaggtgagttatggcctagagatgcagatttctaagccatgaagcttgagttcttatcactttttaactcctgattatttcatgggatgtgtaataataggaaaacattcctaaagtttcttgaaaattcttttaaattaagtttttaaaacatttgttttgttaagaatgtgctcatcgtcaaacgagaattaagatgctgcgcagactcattttgtggatgcttgctaggtcttcaaaacatatgcaccattgaatcactatcaactggccttctgggtactgtccttcaaggatatggttgcacgaattcattctataacattttggataaagatggaaatctgattttcctagttgatggtcaaggatgttgcacaagttgctgctgtgaagataaggattttacggtgacaagactttgccgaatttaaaatactccatacttttcagatcaaaactcccgacagctccgtgccaattggctcaataaccaagaagtggggtggactattgcgtgaagcgtttaccgatgccgacacttttgcagtcacctgtgagttagtcttgaaagtgaaagaatagttgaaagaatttcagttcccatcgaccttgatgtcaagctcaaagcgatactgctgggagccacatttttgattgtgagtttttgtgcttcttatccaaaatttaatttaactattactctattttcaggatttcgtggagttcgaaaataataactgatgtggaaaaactggaaatctcgcaatgcacttctcgcttgttttctgcgatcagagctctaattatgaaatgataatgtgctttctttgtatgcatgtatattaaaataagacattttgcaaacgcg