Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK1098.7   

sjj_ZK1098.7 RNAi JA:ZK1098.7
Simmer:ZK1098.7
PCR_productsjj_ZK1098.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK1098.1 Source_evidenceePCR228WS150 Sequence/Annotation Release
Overlaps_Gene ZK1098.1 Source_evidenceePCR228WS150 Sequence/Annotation Release
Chunk_score (3)
Map_statusBottom50_percentile_ePCRIII95228609523864
ZK1098.7 Source_evidenceePCR457WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusBest_ePCRIII95228609523864
Overlaps_transcript ZK1098.7.1 Source_evidenceePCR443WS150 Sequence/Annotation Release
ZK1098.7.2 Source_evidenceePCR457WS150 Sequence/Annotation Release
ZK1098.1 Source_evidenceePCR228WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK1098.71005gacggaaagataacaacgaattgcaattgggatcaggctgtaaaatggatccagaatgatcctcgtttcagaattctgaacaaagtctcagaaaagaaacaattatttaacgcttggaaagttcaaagaggaaaagaagaaagagtaagttgaaacgaaaaacaaatttatgaacaactacaaactataacttagcatttatttcaaaacgattccattctcgttgagacgtttttgtgtcatctcgaacaactgatcatctgttgcctctgcattttctgatttgactagtttatattcgttgatgaactgctgagagacgcttgttcttgagctatccacttgaataccagccgtacttctgtatgtcttgtagaactttctgaatagagaaaacaatttaaatagtcagcgcctgaaataaccaaaacttacgctctgagaacatcttcctcgtagaaaatagagcgaattggttcgtcgtactttgctaattttacattccaatctggcggtgttaatggtggagatgaaacgtacacatcatacctgaaatgataattatatcacgatatccgcttgaatgagtaaaaatttaccacaaaggacgatctgcccagttcagttgaccagcacggatgagtccagtgactcgcgaaaaaatattaccagaacgttccgcacgagtgataaatgaagccattttgacctgaaaatgattggaaatttgcagaaggagagaagaaattaactttaaaaacggaaaacgcagtaagaatttgcgcacggaaaggtgggaggggcgactccgccccttgcaaggcggcggcgcggttttcggcgggcgattattctctgtgaatatttacgactgcaaagtcacggcttgcaaagtttttataattatttattaaatttcaggatgaaaaacgactggcaatcaaaaagtctaaagaagatttggaaaaattcttgcaagagcatccaaaaatgaaagaaagcctc