Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK1127.5   

sjj_ZK1127.5 RNAi JA:ZK1127.5
Simmer:ZK1127.5
PF:GL1_7F2
PCR_productsjj_ZK1127.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK1127.5 Source_evidenceePCR1037WS150 Sequence/Annotation Release
Overlaps_Gene ZK1127.5 Source_evidenceePCR1037WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRII70506777051807
Overlaps_transcriptZK1127.5 Source_evidenceePCR1037WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK1127.51131gcggaagacccatcagaataataaacatcagaaaaaatgatgatagaccaggaatcagaggtcggtctactcattatcaacttgtatcacataaaatattattacagatttcgaatcaaaactgatcggtctacttgagaaagtgacgaacggtactaaagttgaaatcagtcgaacaggtactcaagtcattttccgaccgggaatgattactggcggtgttgttaatttggattgtggtaccgaaagatgcatttcttactttttggagcctcttctattgctttctcccttctgcaaagttccaatggtaatcaaattgaaaggagttacaaacgcacctggtgaaatctcagtcgatggtatgaaagcttcttggttgaaagtttacaacaaatttgtgctcaatgatgagaaacttgatatcaaaattcaagctcgaggattgaaaccagaaggaggcggtgttgtcgtgtttaccgctccaattgttaaaactcttcggccagtaaaagtgagtttactttattcgtttcttcccaaacaaaatgttaatttaagagacaacaagtcggaaaagtttgtaaaattcgaggtcaagcatatgttactaaagttacaccttcactagcttatcgaatgattgacgctgcaaagaaagcaatgcatgggtacatttcggatgtttatattactgttgatcaacggaaaggtgatgctggtggcgcttctccaggatatggtctgttcttaaccgccgaaacgacagagggtgttatctaccaagcagaagctatttcaagaccgaagggcgaatcaggagttccaattcttccagaagacattggaattgaagccggtcatgctcttcttcaacaaatttacatgggaggtgcccttgacagtagtgctcaaatacttgcaagcacatttatgacactctgtcctaaagatgtttcacacttcctctacggtcctcttccaatgtatagtgtacacgcactcaggcatctcaaacagttttttgagatcgagtttaaaatggaagactttaaaaaaacattgaaggaagaggaagctgatctcaaaacaggaagtgccgataaagctatggttaccgctgttggtgta