Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK1127.7   

sjj_ZK1127.7RNAiSimmer:ZK1127.7
PCR_productsjj_ZK1127.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS ZK1127.7 Source_evidenceePCR1153WS150 Sequence/Annotation Release
K12D12.1 Source_evidenceePCR1162WS150 Sequence/Annotation Release
Overlaps_Gene ZK1127.7 Source_evidenceePCR1153WS150 Sequence/Annotation Release
Chunk_score Abs_score275
Specificity_index0.162
Rel_score0.246
Map_statusTop85_percentile_ePCRII70386897039841
K12D12.1 Source_evidenceePCR1162WS150 Sequence/Annotation Release
Chunk_score Abs_score1120
Max_abs_score1120K12D12.1
Specificity_index0.658
Rel_score1
Map_statusBest_ePCRII1187709111878252
Y46H3C.4 Chunk_score Abs_score104
Specificity_index0.061
Rel_score0.093
K08E5.1 Chunk_score Abs_score202
Specificity_index0.119
Rel_score0.18
Overlaps_transcript ZK1127.7 Source_evidenceePCR1153WS150 Sequence/Annotation Release
K12D12.1 Source_evidenceePCR1162WS150 Sequence/Annotation Release
WB_DNA_text sjj_ZK1127.7_11162ggacgcgacaaatatggagtattcccacttcgaggaaaattgctaaatgtccgagaaggaaatatgaaacaaatcgccgataatgctgaggtcaatgccatgatcaaaattctgggactccaatacaagaagaagtacgagacagaagatgacttcaagactcttcgatacggtaaactgatggtcatggctgatcaggatcaagacggttcacacatcaaaggactcgtgatcaatttcatccatcacttctggccttctctcattcagcggaacttcgtagaagaattcatcactccaattgtcaaagccaccaaaggaaaagaagaagtttccttctattcgctcccagaatattctgagtggagaatgaatacggataactggaagtcgtacaagatcaagtactacaagggattgggtacatcgacttctaaggaagctaaggaatacttcttggacatggttcgtcatcgtatccgcttcaagtacaatggagctgatgatgataacgctgtcgacatggctttctcgaagaagaagattgaagagagaaaagactggctctcgaagtggatgcgggagaagaaggaccgaaagcagcagggacttgctgaagaatatctctacaacaaggacactcgattcgtcaccttcaaagatttcgtcaatcgtgaattggtcctcttctcgaatctcgacaacgagcgttcaattccatgccttgtggatggtttcaagccaggacagcggaaggttctcttcgcgtgcttcaagagagcagacaagcgtgaagtcaaagtagctcaattggctggagctgtcgctgaaatttctgcttaccatcacggagaacagtcgcttatgggaacaattgtgaatctcgctcaagattacgttggctccaacaacatcaacctgcttcttccaatcggacagtttggtactcgtctccaaggtggaaaggacagtgcttcagctcgttacatcttcactcaactgtcgccagtcactcgtacactcttcccggctcacgatgacaatgtccttcgtttcctttatgaagaaaatcagcgtattgagccagaatggtattgcccgattattccaatggtactcgtcaatggagctcaaggcatcggtactggatggtccacgaaca
sjj_ZK1127.7_21153ggacgcgacaaatatggagtattcccatttcgaagaaaattgctaaatgtctgcgatttaaatgtgaatcaaatcgccgatagtgctgaggtcaatgccatcatcaagattctgggactccaatacacgaagaagtacgagacagaagatgactttaagactcttcgatacgggaaattgttaatcatggcaaatcatgattcagacggctctcaattcaaaggacttctgctcaacttctttcatcgcttttggcctgcgctctttaaacgcgacttcgtcgaggatttcatcactccaattgccaaagccaccgaaggaaaagaggaagtttcgttttattcgctcccagaatattctgagtggagaatgaatacggataactggaagtcgtatacgatcaagtactacaacggattggggacattgacttctaaggaagctaagaagtgcttctcggacatggttcgtcatcgtatccgcttcaagtacaacggagctgatgatgataaagctgtcaacatggctttttcaaagaagaagattgaagcaaggacagactatctcatgaagttgatgcaggataagaatcaaagaaagcagcaggggctggctgaagagtgcctctacaacaaagaaactcgatttgtcaccctaaaagatttcttcaactacgaaatagtttgctcatggaatttgcattcaattccatgtcttgtggatggtttgaaaccaggacagcggaaggttctcttcgcgtgcttcaaaagagcaaacaagcgtgaagtcaaagtagctcaactggctggagctgtcgctgaaatttctgcttaccatcacggagaacagtcgcttatgggaacaattgtgaatctcgctcaagattacgttggctcccacaacatcaacctgcttcttcctatcgggcagtttggtactcgtctccaaggtggaaaggacagtgcttcagctcgttccatcttcgctcaactgtcgcaagtcactcgtacactcttcccggctcacgatgacaatgtccttcgtttcctttatgaagaaaatcagcgtattgagccagaatggtattgcccgattattccaatggttctcgtcaatggagctcaaggaaccggtactggatggtccacgaaca