Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK1193.3   

sjj_ZK1193.3RNAiJA:ZK1193.3
PCR_productsjj_ZK1193.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK1193.3 Source_evidenceePCR885WS150 Sequence/Annotation Release
Overlaps_Gene ZK1193.3 Source_evidenceePCR885WS150 Sequence/Annotation Release
Chunk_score Abs_score801
Max_abs_score801ZK1193.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX417448419082
Overlaps_transcriptZK1193.3 Source_evidenceePCR885WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK1193.31635aggacaggaaaacattccaaaatacatctcatattcacactgatctctccatgcacccgatgacgcgtagagcacttgtcgctgacttgtttgagggtctgtgaaattgtattgcaatatatttgtttctacattttggaaaaaaagtatgcatatttacaatcttaccattgaaccaaacaacagcttcaagagttgtgtcgagcggatcgtcaaggtagagagaatccattcttgctaccaaatgagatgtggtttctgtattaactatgttatctttcaaatgttcggtttaaacctacgatagacgggggcatgataggtgtcgtccgtgccaatgttatcggtgacagatgtatagagccggtaggtggatcttcccattaaacgatattggcaaaatgagttgtgagaactgtttgtgttgatgtttaactgaaataaagcgagtttaatcaggtatccctaaaaaattatttatcagatgctattgtttgtctctgaagcgaacaatttagttaggtgattcccaataatgcaggctaataccaaatcttaacattgtttgggatattgtcgaaatcggaatcccgacatctcataggtcccgcgtccaaacagtgcggagcgatgaaaacaaagtagaacgcggccgtgtgtaacggcattgtaactctgtgagcctcactgaataaaaaaatgtgcaacttacgaaatatgctccaactggtggtttttcggtccgccacacataaaaatcaccatttgagtagaaaagttgtggagataattgcgtattattaggcaacgttagtattggggagagatttgctgaaatcgtccattgtttgataaatattatgactaaaataaaaaggtaaacaacttgttgtaaacttcgtccgacatctctcgggttccgccattagatttgttcatttgtatgataataacttgggaactcaaaaaatgttggacaaacacaaaaataacttacatccggaagctctgagagtcaaaaagtcaattgattgatccacaaaaaaaggctgaaacattggcgcttttctgcaatcctccaagtcattcgtcaaaattgtgtcgtattgccaaaggtcctgagcaacggagaacgtggcatctgagagttgcatgagacttgtttgaatcaaaagtccacgggatagttgagataaagatcggagtgattcaaagatgtttgtgcttacatcaacattgcagcttccgcttgcagattcggttatcatgaacaaaatctgagcacgggtgttgacaatctgctccatcaaaaagccagctgtagtgaaatcgtcgtttgctgtcccatccgagaagacaaataccggcgagttctgtaattaagttcgatcgacagacatcataatgtcatgtggtgtcaggctgtcctatttcggtttgatctacctagatttactagaaatgctcaattaatttcgcatggttaagaacgtgctgacgtcacatttttttgcggacaaaattcccgctttttttctagatcacgtgtaatgccacgttttagtagatattaaaaaaaaatttgaaccaccatttgaatttttttttaccagatgtcttgtttcgaaattttgc