Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK1225.2   

sjj_ZK1225.2RNAiJA:ZK1225.2
PCR_productsjj_ZK1225.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK1225.2 Source_evidenceePCR848WS150 Sequence/Annotation Release
Overlaps_Gene ZK1225.2 Source_evidenceePCR848WS150 Sequence/Annotation Release
Chunk_score Abs_score722
Max_abs_score722ZK1225.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1320906313210212
Overlaps_transcriptZK1225.2 Source_evidenceePCR848WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK1225.21150aaactggttttgttttgccgtcgatagaaattcttcaattgaatttcaaaagaaaatgaaacaacttgcagagggcttgccaaatgtcattctacttccaggtaaaagcttaagtttgagaataagacgataattgcatagaaacaatttatttacagtcacagagtcctatgacgaagatggacacaatataaactcagctcactatcgatgcatgatggagcttgttactcgaccaggatggagctatctcgttctcttacaaaactttgaccttataaccaaatcagtgtacgagatggatcgaatttttgaattattggacggagcaaatgatgtaaacttagctagcaaacgaccaggccgaagaaagccaaacctgaagtgggatttgaaaacgctcaagttgtttcgtaatagtgagttgggcacgctttgattattttttgattgtttagacgtctagttgattcaaacccaattttagaattgatccaaacttacgtattttcagaaactattataaataaaacaatattgaactctgaaatcgaaatttcaaccgggtacgtgcaggcctcactgtctcgagcggctgcccaatggttgattaatgacgtcgatgtgacaactttcatgaatcaactaaatcaatctgtaagccctaataaccctcgcctaaaacttgaaaaaaatttttttaggccaaagcttgtgacgagcaatttatttccacttttcaaataaacgaagcattaaaaatgccaggacatttcaccagtcagtgcatccgtcgcggaataagtttacctagttttaccaggtttgtggcgccataaaaaatttttaattgagtactgctccgtattaatagtgttctagattttcccgctgggtccttccggatcagaacactagagaaaattgttcaacacaagccgtaagacataatctgtgtttgtttggtatcgaagacttccgaacgctctccgaaatgccagttttgttatttaataaggtttgagcaaactctttacagcttcaaaacaaatttcagttcaggttattccaggctttgactactctatcgttgattgcactgccgagttaatgtacaatcgaacgtttttgggacaggttgatcacgagt