Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK1248.17   

sjj_ZK1248.17RNAiJA:ZK1248.17
PCR_productsjj_ZK1248.17
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK1248.17 Source_evidenceePCR288WS150 Sequence/Annotation Release
Overlaps_Gene ZK1248.17 Source_evidenceePCR288WS150 Sequence/Annotation Release
Chunk_score Abs_score267
Max_abs_score267ZK1248.17
Specificity_index0.523
Rel_score1
Map_statusUnique_ePCRII58450345845985
K05F1.2 Chunk_score Abs_score84
Specificity_index0.164
Rel_score0.315
K05F1.7 Chunk_score Abs_score79
Specificity_index0.155
Rel_score0.296
ZK1248.6 Chunk_score Abs_score81
Specificity_index0.159
Rel_score0.303
Overlaps_transcriptZK1248.17 Source_evidenceePCR288WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK1248.17952aggagtttcgattttctttctcgattggataacacaacttctgaacatatggtcaatccaaaaaaaaaagaacgatctatcaatgaaactttattgaaagtgttattgaagtgttgggaaagttagatttatgttctttgggttgtactcaatagagaggttcttgcgacgagccataccgtctccttaaaaccattcacggcggaactgcttggcagctccatccggggtgttggtccattcgacggtgatacggtcgttgttggtgtcgtcttgtccgaatgcgaaggcatcacatgaaactgccaacagtacatcttccttgggttcgggcactccacatggtggatcaactccaagtctcttcatgttggtggtcttgttttttaggaaccttgatgtgatacgtgtgcttgtcgtcatatggtgcattgaatacgtgcccggctgggtctggatgtctccgaaccccattccgctgcgttatagtaaatactactttttttttcagattttttgaagcaagcgggaatctcgttgcatatggccatgatttgttggattcgaaaactgagtttaattgtgaataaaatctgatgtttttttaaaggaaaatcacacatatcacagaacataacgatttgaaaacaaaacgacaggctatgttgttttaatggagagaaagacgttctgtttctttcaaatttacttgcaaaaagtatagctgcgaacaaaggagcacagtttctgaatcgtataaaaatattatcacagcctacatcgagcaaaagtcaagttaatcggaagaatgaaggtatactatatttttgcattgaatagctaaattatccaacttttttgtttcaaaaggctttgaaatatttttaatctctctacagtaatctaaccatttagtagagtaagacgacagtgccccgctatattaaaacat