Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK1248.6   

sjj_ZK1248.6RNAiJA:ZK1248.6
PCR_productsjj_ZK1248.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK1248.6 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene ZK1248.6 Source_evidenceePCR419WS150 Sequence/Annotation Release
Chunk_score Abs_score377
Max_abs_score377ZK1248.6
Specificity_index0.35
Rel_score1
Map_statusUnique_ePCRII58093435810367
K05F1.2 Chunk_score Abs_score168
Specificity_index0.156
Rel_score0.446
ZK354.1 Chunk_scoreAbs_score59
ZK1248.17 Chunk_score Abs_score102
Specificity_index0.095
Rel_score0.271
F36H12.7 Chunk_score Abs_score62
Specificity_index0.058
Rel_score0.164
ZK354.10 Chunk_scoreAbs_score59
C34F11.4 Chunk_score Abs_score71
Specificity_index0.066
Rel_score0.188
K05F1.7 Chunk_score Abs_score144
Specificity_index0.134
Rel_score0.382
ZK1248.4 Chunk_score Abs_score74
Specificity_index0.069
Rel_score0.196
ZK354.4 Chunk_scoreAbs_score59
R13H9.4 Chunk_scoreAbs_score59
ZK354.11 Chunk_scoreAbs_score59
R05F9.13 Chunk_score Abs_score78
Specificity_index0.072
Rel_score0.207
Overlaps_transcriptZK1248.6 Source_evidenceePCR419WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK1248.61025atgatacttggcagcagatgtttaaggatacggtaccttccactcaactcataagaaattattttgctggactgcgaagttgtaagctttaaaaaagcaaaatcaaaccaattctaaaagcaggaaaagtgtcgcaatctctgaagatcataccaaggacactctaattgaacactcacaaaactcattatatttttgtcgttgtctcattttccaaagtttcactttgtaatgcttaggattgagcgttgtttcggaaaaatttgtatcgtttccattatgaatatgtgcttatgggagtgagctgattcagaattatatgtaagatgaaacaaaaacaaaaaattcagagaccgttcatttacaaagactgaagaaaaataaagatcgatcggaagattcttgcaagtaatgtctgcagaaatgacaaacctcggaattaccaaataagtaattcaaagccagtggagagtgtcgaaccagctgatctagaggataagggacaagtgagtctatttttgtttgagaaagaaaaacagaggcattaaaaatatttattttacaaggaacctatgggttatactcgattggcaggttcttacgacggaccataccgtctccttggaaccactctcggcggaactgcttggcagctccatccggggtgttggtccattcgacggtgatacggtcgttgttggtgtcctcttgtccaaatgcgaatgcatcacacgaaacagccaagagcacagcttcctttgggtcgagaactccacatggtggatcaactccaagtctcttcatgttggtggtcttgataccgtatccaatacggcgagcagaagagttgatcactttaatgtgatacgtgtgcttgtcgtcgtacggagcattgaagacgatctttgtacccggctgggtctggatgtctcccggtgggacggattgggccatggcgacttcttgtaggagtttttgaaaactcaatgaagcatttgtgaattcttcgaacttatatagggggc