Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK131.1   

sjj_ZK131.1 RNAi (4)
PCR_productsjj_ZK131.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS (3)
Overlaps_Gene ZK131.8 (3)
ZK131.4 Source_evidenceePCR312WS150 Sequence/Annotation Release
Chunk_score Abs_score270
Specificity_index0.287
Rel_score0.865
Map_statusBest_ePCRII1382264513823329
ZK131.1 Source_evidenceePCR312WS150 Sequence/Annotation Release
Chunk_score Abs_score312
Max_abs_score312ZK131.1
Specificity_index0.332
Rel_score1
Map_statusBest_ePCRII1382537613826060
F22B3.1 Chunk_score Abs_score68
Specificity_index0.072
Rel_score0.218
Overlaps_transcript ZK131.8 Source_evidenceePCR312WS150 Sequence/Annotation Release
ZK131.4 Source_evidenceePCR312WS150 Sequence/Annotation Release
ZK131.1 Source_evidenceePCR312WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK131.1685gacgtcataatgagttgagaggggaacacagtccgtcttcgcacctgttttataactgtctactgaaaacaggtagcgtgatgtcatcaaatgcatcatagtcagatagaatcgaagagctatgacgacatatgaatctgagtacagagtctgtactgcagacctccagctttaaaatgttaaagattttaaaacaaaataagtaaaaagaaagacatttattaaaagaacaattcataattggattcagaatatttgtggccctaaagagggccgttgggttcggtagtttggtagattgcatggaagcaagaggacttatcctccgaatccgtacagggttcttccttgacgcttcaaggcatagacaacatccatggcagtgacggtctttctcttggcgtgctcgcagtatgtgacggcatcacggatcacattctcaaggaacaccttgaggactccacgggtttcctcgtagatgagtccagagattctcttgactccacctcttctggcgagacgacgaattgccggcttggtgataccttggatgttatcacgaagcactttgcgatgacgcttggctcctccttttccaaggccttttcctccctttccacgtccggacattgttgacaattgatgaagactcacaagtgagatgaagaactgattgaaattgcct