Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK131.3   

sjj_ZK131.3RNAiSimmer:ZK131.3
PCR_productsjj_ZK131.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK131.3 Source_evidenceePCR411WS150 Sequence/Annotation Release
Overlaps_Gene (5)
Overlaps_transcriptZK131.3 Source_evidenceePCR411WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK131.3937tgaagaactgattgaaattgccttctttatatacccctaatgtctactaacaggtgggaagaggtggagtcacattaagccatcctgtggggacacatttcatagtctacctaacacaccgaatgtctaactgtcgtctgtctcttccttccctccgcctacccaccccacctgcatataaaagaaacgataaggtctcccttttcttcacagtccccacggattaccaaccaaagcatcatggctcgtactaagcaaaccgcccgtaaatcgaccggaggaaaggctccaagaaagcaattggccaccaaggctgcccgtaaatcggctccagcttccggaggtgtcaagaagccacatcgttatcgtccaggaaccgtcgctctacgtgagatcagacgttaccagaaatccaccgagcttctcattcgtagagcgccattccagcgtcttgtccgtgagattgctcaggatttcaagaccgatctccgattccagtcttcagctgttatggctcttcaagaggccgccgaggcttacctcgtcggacttttcgaggataccaacttgtgtgccatccatgctaagcgagttaccattatgccaaaggacatccaattggcaagacgtatccgaggagagcgtgcttaaatgccttccaatggtactgagccagcttgatctcaaaatctaaccgaacccaacggccctctttagggccacaaatgtaatataatccggcttgatttctaataaatttgtattgttgttttttgtcattgtgtattgaatatttctcgaaatattgtgatgaataaaattatattactcagtttttgaacatatgtagattcaaattgaaacaaatttaatatgattgtaaatgcaagggacaactttaagtgtttattctatactcttcttggacccgattttt