Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_ZK131.4_f   

sjj_ZK131.4_fSequenceCATACAAACGCTACAGCAAACAG
In_sequence SUPERLINK_CB_II
ZK131
PCR_product sjj_ZK131.4
smd_ZK131.4