Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_ZK131.5_f   

sjj_ZK131.5_fSequenceTAAAAGAGAAGGGAGACAAGGGT
PCR_product sjj_ZK131.5
sjj_ZK131.5_1
sjj_ZK131.5_2