Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK270.1   

sjj_ZK270.1 RNAi JA:ZK270.1
Simmer:ZK270.1:Repeat_b
Simmer:ZK270.1:Screen_A
Simmer:ZK270.1:Screen_B
PCR_productsjj_ZK270.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK270.1 Source_evidenceePCR1050WS150 Sequence/Annotation Release
Overlaps_Gene ZK270.1 Source_evidenceePCR1050WS150 Sequence/Annotation Release
Chunk_score Abs_score987
Max_abs_score987ZK270.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1490940114910548
Overlaps_transcriptZK270.1 Source_evidenceePCR1050WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK270.11148ttcaggacctcgatttgtccgatggattattggaaaattccgcaaatggggtttcctgatcgccaagcacgcctggcttgctatattaatctgccttattatctccacacttgccatagtgaaaattttactcaccaaacaagcaaatgatatcacaggatatacaccttacggagcacgagcaaaagacgagtatctagagtatcagaagtttttctcaagctcaggattgcctatcgccgcctatctttatattgtggcaaaggatgaaggaagtatgtcacgcccggattacttggatgaaaccattcaagttttgaatttcgctttgaacaatatcacaatgtatgattcgatttctggaaagagtgagacattcaatcagttttgccagagtttctgccaaatcaatgaaccagttcggcagttttatgtaagttttgaaagttcaccactttttatgcttcccaatttcagaatggttaccaaattttgagtgatggggaacaaaattcgagaattaagattcagtacccagtatctgatatgtttggaagacagttttctcttcagccaaacttttttggagttgaattgttcgatcaaccagatgacgcagctaaacttcttgactctgctgacggagatccagtcattggtaggtgactttgtatcttaccttttaaaaaccttattaaactttgaagaactaaacgccactaaactcgtcgatccggtctccaggataacaaatgtaaagtcagtcaaaatgattacattgcaatttcgtgccgaacacaagcctggatggaccgaagcacaggtgaaaaaatgggaaatgagtttggtggacatttttgaaaaacgatacaattccaaacgtttgaaaatttacgcttattctcaatcatacgtggaagaggagatggttcgaggcggaattatcatgattccctacctcgttgtaggatttgctataatgtgcctctgtagttgcgtgctcgttatgatacgtgctctgtacatgcatcaagagaatggatataaaatcattctcgcaattatggcatgtctgactcctcttttggcttgtgccactgcactggctctcatgttcctgtgcggagttcggttcgcttcaattctct