Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK285.1   

sjj_ZK285.1RNAiJA:ZK285.1
PCR_productsjj_ZK285.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK285.1 Source_evidenceePCR703WS150 Sequence/Annotation Release
Overlaps_Gene ZK285.1 (3)
Overlaps_transcriptZK285.1 Source_evidenceePCR703WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK285.11402cggaaagtcaccacctcagttagggacctataagtggctcatgttgtatacatccttatatgagttagtttatacatcaatgaatatatttgtagaaccagtaggttttttgttaaaagtttttggcgtaaaaggcgattttcagtccactggtacatttcaatcgtcttgctacatgtttcaagatatgaaaaagagcatgtttggtgccgacgggacattgtttttcatatgttagtaagcattagtgctgtgcggaacttgtaaactgtcggaacatccatatcttctaacttaatgctaagtttaagaccctctgaacaaaattatacatcattgggcaacaaactgcgaattaaaaattattattgggaattttttcagtgatttactgctcatgctatggattttcaatgtcaatttttgcttgccactttatttatcgttatggtaacgttaacacgtaagctcaccgggaccaactccaaaatatttatcaacttttcagaatcttcaagcaaaagtacatatctggtaaaaaacatttattcctatacattgctccattgttgagtggatttgtttggggactggtgacttggctaacaatgcacgagtcttcatcgaaaactagttttttgaagtattgagtattattactccctcttcgatgtagttttttttccagaattcatttcgaacaagttttaaaattgaacattgaagagtgtgcatacgtcgctttttggttttggcccgttgatgaacacggagaatttcagcctgatttaatatcctttctaggttttggaattatgattctgattctggtaattattttgattgttttacttaggcaacaatccaaaatgttttactcaattgaaatcttttcagagttggtcgtttatcagtgtcgtttatttcggtttcaattgttataaatacatctcaaaacaaatgggaagtttatcatcgcaatcgcaggctctgaaatctcttcaagctcaactgttctactctttaattttccaaaccgcaattccctgtgttttgatgtatctgcctgctgggattattttaagtgttcctatgtttaatgttggtttcaacttggaagttccacttctttccatcactatagcaatctacccggcaatcgatccacttccaacaattttcataatcaaaagctacagaagagggttgattgatatgtttcggtgtcacaagaaaaccctgattgtagctagttcgtaacaagatatttattgaattcgcatgtttttcagtgtcgtttattttgaaataataataaataactaggttacgtttgtggacttgaaccggaacaagttgaaaagttgagtctttgagtcttttgaaccctttccgtaaatgc