Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK328.2   

sjj_ZK328.2 RNAi (3)
PCR_productsjj_ZK328.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK328.2 Source_evidenceePCR1152WS150 Sequence/Annotation Release
Overlaps_Gene ZK328.2 Source_evidenceePCR1152WS150 Sequence/Annotation Release
Chunk_score Abs_score1110
Max_abs_score1110ZK328.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII60104456011643
Overlaps_transcriptZK328.2 Source_evidenceePCR1152WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK328.21199gcacttttgccgaagaagacgttccagtactctctccacttaacggcaacgttattttttcatcgggacgatacaatgtctgcttttctctattgtctttttcgaatatctatgcgaaacaacatggtaagaagcttacgaaattaatgtcttgcacgatttttattttccaggtgactccttcaactcaaaggagtttgctcgccgtctctggggagatatttacttcgagaagaaaactcgcaaattcgtaaagaagtcgccgtcccatgatgctccacgtacatttgtgcagttcattctcgagccaatgtacaagatcttttcgcaagtcgtcggagatgtcgatacttgccttcctgatgtgatggctgagttgggaattcgtttgtcaaaagaagaacagaaaatgaatgtccgtccattgattgctctcatctgtaaacgcttctttggagatttcagtgcatttgttgatttggtggttcaaaatatcaaatcaccacttgaaaatgcgaaaactaaaatcgagcagacatatcttggaccagctgattcccaattggctcaagaaatgcagaaatgtaatgctgaaggaccattgatggttcatacaacaaagaattatcccgtagatgatgcaactcagttccatgtatttggacgtgttatgagcggaacattggaagcaaatacagacgtccgtgtacttggagagaactacagtattcaagatgaagaagattgccgaagaatgacagttggaagactatttgtgcgtgttgccagttatcagattgaagtttctcgtgttcctgcaggttgctgggtacttattgaaggaattgatcagccaattgttaaaactgcaaccattgctgagttgggatacgaggaagatgtctacattttccgtcctctcaaattcaacactcgcagttgcgtgaaacttgccgtagagccgattaatccatccgaactcccgaaaatgttggatggcttgagaaaagtcaacaagtcatatccgttgctgacgactagagttgaagaatccggagagcacgtgttgctcggaactggagaattttatatggactgtgtgatgcacgacatgcgaaaggtgttctcagagattgatatcaaagttgctgatccagttgtcacattcaacgagactgtcatcgaaacgagtacgctga