Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK337.2   

sjj_ZK337.2RNAiJA:ZK337.2
PCR_productsjj_ZK337.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK337.2 Source_evidenceePCR1168WS150 Sequence/Annotation Release
Overlaps_Gene ZK337.2 Source_evidenceePCR1306WS150 Sequence/Annotation Release
Chunk_score Abs_score1180
Max_abs_score1180ZK337.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1497867014980773
Overlaps_transcriptZK337.2 Source_evidenceePCR1306WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK337.22104ttccaaaactttaagcggacataactttctttggaaaatttttggaacgtctcattacgaaattcctgagttgatgcggatatttaaagttgatatatctacaggtttgaagctcgctcggtgtcctcgctgggccacagcacagcccactttaatcaattgctcgcggcgggtgctgcatatgaactatccaggtgacaataataactccgactcctgtttttaaaattaagtgttatgcagagagcgtagcaggtcagaaagcgatatgcaacccacgcaggaggatgacgtgaggcatcttaacacatcgactatctcggtgccgatttacgctaaaaaaccgcttcacaagtttggcggggagatcaagcggagtagtagtacgccaccaccgacgtctgatgagcgagagcaggtggagcagcggttgttgttgagaccttcgtcgggaatggaaatcaagaaggacttggaaacggtatagcactccacctacatctcaacattgtctatatttcagaccaattcctttgtgagcagctgggctcgagaacagatttttgccatgcagaatgcaaccatgtacaatttgttaaccgctcgttctgcagaagattgttcaactatttcgacaccaggacctttgaaagttttccccagaagcaaagatgacatgacgttcgcaccgagagatgactcaagtcgtgccaagcaaatgcagtacccatgtacactttgtgggcaggtacacatttgtcgaaatggaggaccctacacaatttttttcaggcgtttgcggtacatgatcgattagctaagcatatagcgtctcgacatcgccagcgaagttgtacattagatgatgcttctaaagtccacaaatgcaacatgtgctcaaaaagcttctcgagaagtgatatgctgacaaggtatacaattttgattagacaaaacgacacatattttttattcaggcacatgcgtcttcacacgggagcaaaaccatacagttgtccgacatgtaatcaagtattctctcgttctgaccatttatccactcatctgagaacacatacaggcgaaaaaccatacgcgtgtccaatgtgtaattattcagcggtaagtatgttcagatcattcaaatcattatgttagattccgcgtgctttggagtctagttgatttccgtttaaaacacacgtccactttcccaatcacagcttaacttggaacagaacatagtcctatcttctggctggtgtcgcgtttaagattaaacatttctaatatttgcttcatgatcaagatttaaatacgtctgaatcatttttcatcatgcgacgctaaccagacgtgagatctaaagactctcggtaaaataatgttgaactgctcgaatatactcagattttcaaagtaaaagtcaacacataatatttatagagccgccgcgacatgatctcccgtcacatgcgaactcattcactgacagatgactccagtatctcaactccaatatctcaattgtcaatccgaagtgcaactacttcaccactaccaccaaagatcgggtcaactgcaaccgttgaaattggttctggattgttgtccgcattcaaaccaatactttccgcatcatcatcaaatcttctttccgtgtcttcacccttccaatcactttctctctcaacaccaccatctccatcgttcgcacctattgtactcaatcggcagttatcatttgatgttacgatgcgcaatactacgtcttgatacctgtatcaggttccttccgttttttgctctatgaacaaaagtaaatgaacaaaaaactttaaatttcaatgacgggtttcgcctcgattactgtaattttattaatattatatataaataaaaaatttaatatatagtttttgtttcgccagaagttaaatttttgatgaaaaattttctgaagaaatttcagaaaagtgtgtggaagccattggcaaaatttaagaaggtatacatttttcttgcagacattaataatgcatccagccattttcgagatatactcagtaatgggcatacggcagagaaaatttggtcaaggttg