Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK354.1   

sjj_ZK354.1RNAiJA:ZK354.1
PCR_productsjj_ZK354.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK354.1 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (35)
Overlaps_transcriptZK354.1 Source_evidenceePCR430WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK354.1801aacagtgaatttttgagagcagcatgtaagtgtaataacatccttttttttcgagaaaaaagttctctggttatatccaacattttctgtattgaaaatttataatttagattatttttgtaatgtttcaagttgtcaacaagttacattccttgaaagttcaaagttttaggctgaattgtaatattttcgcgtaatctcctatttttggatgaactttcagatctaggacaaagataagaaggttgctataaattgagaaggttttgtcataatcttcactgcgagttctcataactccttcaacaagtcgccatggcccaatccgttccaccaggagacatccaaacccagccgggtaccaagatcgtcttcaatgccccatacgatgacaagcacacctaccacatcaaggtgatcaactcgtcggctcgccgtattggatacggtatcaagaccaccaatatgaagagacttggagttgatccaccatgtggagttctcgacccaaaggaagcagttcttcttgccgtttcctgcgatgctttcgcctttggacaggaggatacaaacaacgaccgtatcactgttgagtggaccaacaccccggatggagctgccaagcaattccgccgtgaatggttccaaggagacggtatggttcgtcgcaagaacctcccaatcgagtacaacccatagagcccttagctatctttttcaataaatgatttttgaaagctcgttgttttttttttcatttgtttcaaattttcagatttcaaaatcaatcaaatccaatcc