Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_ZK354.1_b   

sjj_ZK354.1_bSequenceGGATTGGATTTGATTGATTTTGA
PCR_productsjj_ZK354.1