Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK381.1   

sjj_ZK381.1 RNAi (2)
PCR_productsjj_ZK381.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK381.1 Source_evidenceePCR802WS150 Sequence/Annotation Release
Overlaps_Gene ZK381.1 Source_evidenceePCR901WS150 Sequence/Annotation Release
Chunk_score Abs_score817
Max_abs_score817ZK381.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV69775846978619
Overlaps_transcriptZK381.1 Source_evidenceePCR901WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK381.11036tcccgttgatctagagattgaaaaaaattctgaaatgtttgcgcttcgctacataaaatgtgcttcggccttcattctcgatcgccgtggcattttggacgaaaaatgcttcaaaactcgaacaataggtatggcttattttacaatgtatcacaaatatttttatacagataaactgttggtcaccgcattccagagcagtgttcctgccgcaaagcgtgtgtcttcaacattcgacggattgagagatgcgattcaacaaggctatttgcgagagttcgcaatcgtgttctacaagaagccaaacgaggaagacattaatgaagtgtttgcgttcaggtttgcttatggagatgaaggagagattttcgtatctctaaataagtaagctgctggtcttattcaattattcgttttcaattgttttcagcggaatcgacacgaacgaaagcagtcaagaactgttacaggcgaaattcgttgataccgacaacacgaaacaaatgtttgcaagcacaatcaagaaacttcaccggtgtatcaagaaaatggagccgcttcctcaagggtccgacgcgagtttccgtgtttcgtacactgaaagtaggttacattcacagctttagtctatttctaactgttattttaagaagctccaaaagactatacacccgaaggctatctgctgagtcctatgttctatacgctgaatcaggatattaggaaagcatctattggaatcgtgtgtggcggtcatcacaaaattcaaatgcttgctgcttcacaatacttgaagcaagacttcgatctggataaaacgaccacactcaatccaaatatgtcaatcatggcaaaccaatcgaaaaggaagggacgaatttccagagattccccttacggtctcagtcagggcattacgaagaagaataaggactagtcgaaaagttttcactcatgtgcaatgtttctcttgttttatatttttagccattgtttttataatttcattgattgtcgtgcttttgtcttctcttgt