Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK381.1   

sjj_ZK381.1 RNAi JA:ZK381.1
PF:GL1_4C3
PCR_productsjj_ZK381.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK381.1 Source_evidenceePCR802WS150 Sequence/Annotation Release
Overlaps_Gene ZK381.1 (3)
Overlaps_transcriptZK381.1 Source_evidenceePCR901WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK381.11036tcccgttgatctagagattgaaaaaaattctgaaatgtttgcgcttcgctacataaaatgtgcttcggccttcattctcgatcgccgtggcattttggacgaaaaatgcttcaaaactcgaacaataggtatggcttattttacaatgtatcacaaatatttttatacagataaactgttggtcaccgcattccagagcagtgttcctgccgcaaagcgtgtgtcttcaacattcgacggattgagagatgcgattcaacaaggctatttgcgagagttcgcaatcgtgttctacaagaagccaaacgaggaagacattaatgaagtgtttgcgttcaggtttgcttatggagatgaaggagagattttcgtatctctaaataagtaagctgctggtcttattcaattattcgttttcaattgttttcagcggaatcgacacgaacgaaagcagtcaagaactgttacaggcgaaattcgttgataccgacaacacgaaacaaatgtttgcaagcacaatcaagaaacttcaccggtgtatcaagaaaatggagccgcttcctcaagggtccgacgcgagtttccgtgtttcgtacactgaaagtaggttacattcacagctttagtctatttctaactgttattttaagaagctccaaaagactatacacccgaaggctatctgctgagtcctatgttctatacgctgaatcaggatattaggaaagcatctattggaatcgtgtgtggcggtcatcacaaaattcaaatgcttgctgcttcacaatacttgaagcaagacttcgatctggataaaacgaccacactcaatccaaatatgtcaatcatggcaaaccaatcgaaaaggaagggacgaatttccagagattccccttacggtctcagtcagggcattacgaagaagaataaggactagtcgaaaagttttcactcatgtgcaatgtttctcttgttttatatttttagccattgtttttataatttcattgattgtcgtgcttttgtcttctcttgt