Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK384.3   

sjj_ZK384.3RNAiJA:ZK384.3
PCR_productsjj_ZK384.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK384.3 Source_evidenceePCR823WS150 Sequence/Annotation Release
Overlaps_Gene ZK384.3 Source_evidenceePCR823WS150 Sequence/Annotation Release
Chunk_score Abs_score793
Max_abs_score793ZK384.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1873292218734071
Overlaps_transcriptZK384.3 Source_evidenceePCR823WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK384.31150acatcctcaacgtactcgggagcactgatagggaatttttctgctccaatggtaaagacaaggtcaggcagtgagttcatagtggagcacgggactgtgtagacactggcatacaaatcccaggtggcgttagtctgtgttgctatcccggctataacggagtatggtaagccaaaccaggaggatccggtgtccattatagcctgttcaataaattatataataataatttcatttcatttcaggcaccaagtgatgtcaggctgtcacattacggtttgatctacaaaaaaaatgcggggcttatctcccatagaaatttgacgtcagcacgttttgaaccatgcaaaaccagattctcaactcccgcgcgatctacaaaaaaaagcgagaattttcgccccaaaaaatgtgacgtcagcacgttcttaatcatgcaaaatcagattctcaactcccgccctttttgtagatctacgtagatcaaaccgaaatgggacaccactctgactgttttttgttactgttacctgatctctgttaacagtccgattgtaggttccaacttgaaaaccgtcaactttaaactgccagtatgtctttgaagataccggaacataagaaatatttgcattgcagttcttggtgtctaagcctccgtaggtgataagtccattggatgggtaatagtagtctggatcccgtttatcaaagaaaattgtgaatatcggagcgtccagttgattttgggagacgaggttctgcattggtggagtgacttgatcaacggatagtgctggccatgcaagcccgaaaattccatcaataggccgagttccgaaatcataatcaacaatgtttgcaactccgaactcttgtttctgaattttcagtcctccaatctcaacagtatccgttcccaggtacccactgcactcgcctgatccatattgaatattaaatttgcgattacttttaacaaagcttgttgatttagttgtgttgaacttatgcttgatgatccctaagagaggatcattgcaattcactgaggtgcacgcggagcccatcacccacaagttggctgaagtggtgtccatgaaaacaaacgctgactgtggcggggacccgatggtgatattcccgatgc