Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK507.1   

sjj_ZK507.1RNAiJA:ZK507.1
PCR_productsjj_ZK507.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK507.1 Source_evidenceePCR685WS150 Sequence/Annotation Release
Overlaps_Gene ZK507.1 Source_evidenceePCR685WS150 Sequence/Annotation Release
Chunk_score Abs_score540
Max_abs_score540ZK507.1
Specificity_index0.696
Rel_score1
Map_statusUnique_ePCRIII90996059100590
ZK507.3 Chunk_score Abs_score236
Specificity_index0.304
Rel_score0.437
Overlaps_transcriptZK507.1 Source_evidenceePCR685WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK507.1986atcttgagggctttttgtttttcgaattattgaagctcaaagttccagttttactacgatccagcgaattctcctcatttcgatccgatgcaattgacttcagatcaatattggttgcctgaaagaaataattgtgagcatttttgtcaaaaaacagagaactcaccattctcgaggctcccgttccaggagcagtacttggtgatggacacgtagattgattaaaccaaaccaaaggttctttcagagtcaacttacagcctcgagcgtagtccgtgatagcttctcgcagaacactgaaaattggaaatttattggaataaaaactttttctgcactttatagaataaaaaaatcatgaatttacccgaatttaacctccgaatcgtagaccaaattgtccaagtagatggaaatcaccttgaacatcggatgtttttcatatgctgaaaataaattaatgaatttatgtaattttttaaataattacttttcaatttggtgaacaattcctgcttctttgcataggcatctggacgagtgagtcctttccaatcaatcaatgtggtgtcgacaagatcaatgaactgaaaacaatattcatgaaaagcatcttttaccaaaaatctattgaattgtatcctttctccacctctgccaaatatacatctacataaaattgcaacttaccataaagaaccaactttcataatcatctctccgaccaagttcttcacatcgatgtgatgctcttgaacagtacctcggagttccaatcattttagtctttggccgtggtggacgaacttgaccattcgggagacgatactttctggcgagtccaaaatcgagtacataaattgtttcgcttttggatccatagccgatacagtaattggctggtttgatgtctctatgaaggaacccgatttggtgaaagtcgtgaattgcctgaaaatttagattttgtctacattgagccctca