Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK507.3   

sjj_ZK507.3RNAiJA:ZK507.3
PCR_productsjj_ZK507.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK507.3 Source_evidenceePCR667WS150 Sequence/Annotation Release
Overlaps_Gene ZK507.3 Source_evidenceePCR667WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII91020489103185
ZK507.1 Chunk_score (3)
Overlaps_transcriptZK507.3 Source_evidenceePCR667WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK507.31138gttccttcatcgagacatcaaaccagccaattactgtatcggctatggatccaaaagcgaaacaatttatgtactcgattttggactcgccagaaagtatcgtctccccgaatggtcaagttcgtccaccacggccaaagactaaaatgattggaactccgaggtactgttcaagagcatcacatcgatgtgaagaacttggtcggagagatgattatgaaagttggttctttatggtaagttgcaattttatgtagatgtatatttggcagaggtggagaaaggatacaattcaatagatttttggtaaaagatgcttttcatgaatattgttttcagttcattgatcttgtcgacaccacattgattgattggaaaggactcactcgtccagatgcctatgcaaagaagcaggaattgttcaccaaattgaaaagtaattatttaaaaaattacataaattcattaatttattttcagcatatgaaaaagaaccgatgttcaaggtgatttccatctacttagacactttggtctacgattcggatgttaaattcgggtaagttcatgtgtatttttgtcgataatttccaattttcagttttctacgggatgctatcacggactacgcacgaagctgcaagttgactctgaaagaaccattggtttggttcaaggaacggaatgataatgaatctggatcgacaccaactacttctgccaccgcctgctcaccatcatctagtactggaactggaacaggaacaggagtttcgaaaattgtgagttgctttgcttttgacaagtaatgttattgttttcttttttcaggcatccaatattgatcaaaaatcaattgcatcggatcgaaatgaggagaactcgctggatggtagtaaaactggaacatggaagagcaccaaaacgagaaacaagaagccttctagaaaataaagaacttccatttattgaatgtttactggataatgcaacagttacagtgaaagataaccgtgttaaaaagtttaacaagttatacaatattaatccggaagaagtatacaaaaaattcaagggggaccagtttctgggtgatgtagtgagatgagcatatttaaaatgaaccgagcagttagga