Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_ZK507.3_b   

sjj_ZK507.3_bSequenceTCCTAACTGCTCGGTTCATTTTA
PCR_productsjj_ZK507.3