Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK546.3   

sjj_ZK546.3RNAiJA:ZK546.3
PCR_productsjj_ZK546.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK546.3 Source_evidenceePCR402WS150 Sequence/Annotation Release
Overlaps_Gene (19)
Overlaps_transcriptZK546.3 Source_evidenceePCR402WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK546.3967aggcacatcatgtattttcgagtgggtctcgccacgaactcagttcaagtggccgctacaggtgccaaattttcgcaaatatgtttgttagatgtagaaaattacttatataattttaaaattttaaaattgcatatagaaagctattatttatgattaaaaatttcgaagtggaggaaattttcaattttctatagattttctagacagctcggaaaatttgataaattgtgggaagttgggtctgactagattaattagttcggtcaagttaggcaatcctggaggaaaatttcttaaattgtataagatttttgaaatcataaaaagcattcaatttgtgagaagttttacggatttcaaaaataattgtatttatttattaactttttgaactaatattagagatgtgacaaaatatccattatgacctttacgtgaggatattaatgtgaagatctgggacaaagataagagagaaatttgctataaattgagcagagtttaccataatcttcactgtaagtttccacactctacaaagaagtcgccagtgcccaatccgtcccaccaggagatatccagacccagccgggtacgaagatcgtgttcaatgcaccgtacgacgacaagcacacctaccacatcaaggtgatcaactcctcggctcgccgtattggatacggtatcaagaccaccaatataaagagacttggagttgatccaccatgtggagttttggacccaaaggaagctgttcttcttgctgtttcctgcgatgccttcgctttcggacaggaggacactaacaacgatcgtatcactgttgagtggaccaacactccggatggtgctgctaagcaattccgtcgggaatggtttcaaggagacggtatggttcgtcgtaagaacctcccaatcgagtacaacccataggaaatacatcttgaactttttccaaaaccaa