Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK637.8   

sjj_ZK637.8 RNAi JA:ZK637.8
Simmer:ZK637.8
PCR_productsjj_ZK637.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS (6)
Overlaps_Gene ZK637.8 Source_evidenceePCR857WS150 Sequence/Annotation Release
Chunk_score Abs_score836
Max_abs_score836ZK637.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII89080998908955
Overlaps_transcript (6)
WB_DNA_textsjj_ZK637.8857gaatcgaatggagacaaatgaagctcctccgacatacaataagacgaacaagttcacaaaaggattccaaaacattgttgatgcatatggaattgcaacatatcgagaaataaatccagctccatacacaatgatctcgttccctttcctttttgctgtgatgttcggtgatatggggcacggagccatcatgttacttgctgctcttttctttattctcaaagagaaacaactcgaagcggcacgaatcaaagatgagatcttccaaacattctttggaggtcgttatgtgatctttttgatgggagctttctcaatatacactggattcatgtacaatgatgtcttctcgaaaagtatcaacacatttgggtcatcatggcagaatacaattcctgaaagtgttattgattattacctggacgacgagaaacgatcagaatctcagcttattcttccaccagagacagcttttgatggaaatccgtatccaattggagtggatccagtttggaatcttgccgaaggaaacaaattgtcattcctcaactcgatgaaaatgaaaatgtccgtattattcggaattgctcaaatgacattcggagttctcctctcatatcaaaatttcatatatttcaaatctgatcttgatattaagtacatgttcattccacaaatgatattcttgtcatcgatattcatttatctgtgcatccaaatcctttcaaaatggctattcttcggtgctgttggtggaactgttcttggctacaagtatcctggttcgaattgtgctccatcccttctcatcggtctcatcaacatgttcatgatgaaaagtcgtaatgctggatttg