Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK675.2   

sjj_ZK675.2 RNAi JA:ZK675.2
Simmer:ZK675.2
PCR_productsjj_ZK675.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK675.2 Source_evidenceePCR965WS150 Sequence/Annotation Release
Overlaps_Gene ZK675.2 Source_evidenceePCR965WS150 Sequence/Annotation Release
Chunk_score Abs_score881
Max_abs_score881ZK675.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII79029267904032
Overlaps_transcriptZK675.2 Source_evidenceePCR965WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK675.21107gagaagactcaatgcccagccagtgttggaataggatctacgagcttgttagcaagacttgcaacaagacatgctaaaccagatggagttttttgggttaatgcacataagaaaaatgaattcatttccgaggaaaaagttaaagatctaccaggatttggatacgaaatgatgaatagattaacttcattctttggtaattccagtatctaatataaaaatatcaacttctcagttttacaggtgatattacaaaatgccgtgaactacaattaaaaactgaacgggaacttgtacctgtattcggaccaaagttggcttcaaaaatattacgacaatgtcgtggtattgaagaagatccagatgatttttgggctactcatgttcgaaaatcagtatcatgtgatatcaattatggtattcgtttcacgaaggtaatgtattatattaaaatgtccgtataacgatggaatatttcagagaggtgaagttattcaactcatgacagctattggagctgagttagaacggaaacttatcgatagtaaattaaccgcaggatccataactttgaagcttatggtacgttcagcaaatgctcctatacaaacatccaaattcatgggacatggaatttgtgatacatttaccaaaacgtgtaatctaaacgttccaactacacgcggagagtctctcacatcagaagctatgaaattatatgctaaagtttctccgaaagtagaagatcttcgtggagttggagttacctgtggaaagttgaaaagtaaattgaaaaaagatgcggcaacggcagtgcaagagatgtttgggaagacctctagagttgggaatatggcgagaactgacgaacaattgagttagtatttaagtagtgaaattttattgaaaacattctgtattttcagatattattccgcgaaacgaagatgaactagataaagaacctgtgataattccagctgtgactgaagatctggaagtgcaaagcatacctcgtcaaattaattttagagtggcaaatgacatagatattcctgaaattgtaaaatccacacttctcaatggacgatctgacaacaacctcga